Research Article
Print
Research Article
On the validity of Hebius sauteri maximus (Malnate, 1962) (Squamata, Natricidae), with the redescription of H. maximus comb. nov. and H. sauteri (Boulenger, 1909)
expand article infoMao-Liang Li‡§, Jin-Long Ren§, Jun-Jie Huang§, Zhi-Tong Lyu|, Shuo Qi|, Ke Jiang§, Ying-Yong Wang|, Jia-Tang Li§
‡ Huazhong Agricultural University, Wuhan, China
§ Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, China
| Sun Yat-Sen University, Guangzhou, China
¶ Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences, Yezin, Myanmar

Corresponding author: Jin-Long Ren ( renjl@cib.ac.cn )

Corresponding author: Jia-Tang Li ( lijt@cib.ac.cn )

Academic editor: Silke Schweiger
© 2022 Mao-Liang Li, Jin-Long Ren, Jun-Jie Huang, Zhi-Tong Lyu, Shuo Qi, Ke Jiang, Ying-Yong Wang, Jia-Tang Li.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Li M-L, Ren J-L, Huang J-J, Lyu Z-T, Qi S, Jiang K, Wang Y-Y, Li J-T (2022) On the validity of Hebius sauteri maximus (Malnate, 1962) (Squamata, Natricidae), with the redescription of H. maximus comb. nov. and H. sauteri (Boulenger, 1909). Herpetozoa 35: 265-282. https://doi.org/10.3897/herpetozoa.35.e94920
ZooBank: urn:lsid:zoobank.org:pub:29C2ED3F-BC5E-45E7-8E58-FCC93B988455
Open Access

Abstract

Hebius sauteri (Boulenger, 1909) has been long recognized as a widely distributed species with three subspecies, namely Hebius sauteri sauteri from Taiwan Island and southeastern China, Hebius sauteri bourreti (Malnate, 1962) from northern Vietnam, and Hebius sauteri maximus (Malnate, 1962) from Sichuan, southwestern China. However, the validity of these subspecies of the H. sauteri complex has not been evaluated. In the current study, we re-evaluate the taxonomic status of H. s. maximus based on morphological and molecular evidence. Molecular phylogenetic results indicate that H. s. maximus is a distantly diverged clade with respect to H. s. sauteri, and that H. s. maximus is morphologically distinguishable from the nominative subspecies. Therefore, our results support the validity of H. s. maximus and we elevate it to full species status, namely Hebius maximus comb. nov. The distribution range of H. sauteri is revised according to our proposed taxonomic change. Furthermore, detailed redescription, natural history, and coloration of both H. sauteri and H. maximus and comments on the validity of H. s. bourreti are also provided.

Key Words

distribution, hemipenis, revision, subspecies, taxonomic confusion

Introduction

Keelback snakes of the family Natricidae Bonaparte, 1840 represent a remarkable radiation of snakes in the world, which show unique adaptation to humid or riparian habitats (Narayanan et al. 2020; Peng et al. 2022). The genus Hebius Thompson, 1913 is the most speciose group within Natricidae; members of the genus Hebius are widely distributed across South and East Asia, as well as Southeast Asia (Guo et al. 2014). The genus Hebius was previously combined with the genus Amphiesma Duméril, Bibron, & Duméril, 1854 sensu lato and was recently resurrected by Guo et al. (2014). Currently, the genus Hebius includes 48 species, of which 23 species are known from China (Wang et al. 2020; David et al. 2021; Hou et al. 2021; Hauser et al. 2022; Ren et al. 2022; Uetz et al. 2022).

Hebius sauteri (Boulenger, 1909) is a small to medium-sized snake inhabiting moist mountains and often found near water. Described based on two specimens from Taiwan Island, southeastern China, the species was subsequently reported across southern China and northern Vietnam (Boulenger 1909; Zhao 2006). Malnate (1962) divided H. sauteri into three subspecies according to ventral and subcaudal scale counts and coloration, namely H. sauteri sauteri from Taiwan Island and southeastern mainland China, H. sauteri bourreti from northern Vietnam, and H. sauteri maximus from Sichuan, southwestern China. However, the systematic status of three subspecies in H. sauteri has long remained inconclusive (Zhao et al. 1998; Zhao 2006; Guo et al. 2014). Although the taxonomic treatment of Malnate (1962) has been accepted by most authors (e.g., Zhao et al. 1998; Zhao 2006; Yang and Rao 2008; Nguyen et al. 2009; Xiang et al. 2009; Zhang 2009), some studies consider H. sauteri a monotypic species (Wallach et al. 2014). No recent study has yet examined the controversial taxonomy of the subspecies of H. sauteri.

Based on the examination of voucher specimens in natural history collection and individuals newly collected from the field, we re-evaluated the taxonomic status of H. s. sauteri and H. s. maximus by using morphological and molecular phylogenetic data, and discussed the taxonomic status of H. s. bourreti.

Materials and methods

Sampling

During field surveys conducted in the last five years, nine specimens of H. sauteri were collected in Sichuan, Guizhou, Guangdong, and Fujian, including one specimen near the type locality of H. s. maximus (CIB 118635). Specimens collected in the field were euthanatized and preserved in 10% formalin and then transferred to 75% ethanol, and all newly collected specimens were deposited in the Herpetological Museum, Chengdu Institute of Biology (CIB), Chinese Academy of Sciences, Chengdu, China, and the Museum of Biology, School of Life Sciences, Sun Yat-Sen University (SYS), Guangzhou, China. Other specimens or tissue samples used in this study were obtained from institution collections (see collection abbreviations).

Morphological analysis

A total of 44 specimens of H. sauteri were examined in this study. The description and measurements of morphological characters were obtained according to Zhao (2006), Ren et al. (2018) and Ren (2019). A tape measure with 1 mm accuracy was used to measure the total length (ToL) and tail length (TL). The head length (HL), head width (HW), eye width (EW), and distance between the lower margins of eye and lip (SoL) were taken with a slide-caliper with a minimum accuracy of 0.01 mm. Other pholidosis counts were also examined for comparison, including the number of internasal (IN), prefrontal (PrF), loreal (L), frontal (F), parietal (P), preocular (PrO), postocular (PtO), supraocular (SpO), supralabial (SpL), infralabial (IfL), temporal (TEM), chin-shield (CS), dorsal scale rows (DSR), ventral (V) and subcaudal (SC). Additionally, the number and shape of maxillary teeth (MT), and keeling status of the dorsal scale rows (KDSR) were also described.

The hemipenes of one adult specimen of H. s. maximus near the type locality (CIB 118635) and one adult specimen of H. s. sauteri (SYS r000323) were everted from the left side and used for hemipenial description; the preparation method of hemipenis eversion followed Jiang (2010). The description of hemipenial characters followed Zhang et al. (1984). The everted hemipenis was re-inflated with colored petroleum jelly. We photographed the hemipenis using a digital camera attached to a tripod head and performed the combination and montage of multifocal photographs using the Helicon Focus (7.0.2 Pro) software.

The following measurements were also used for hemipenial description: hemipenial total length (HTL): distance from the bottom of the truncus to the tip of the most distant point in the vertical direction; hemipenial truncus length (HCL): distance from the bottom of the truncus to the tip of crotch in the vertical direction; hemipenial total width (HTW): the widest distance of the hemipenis in the horizontal direction. The following ratios were also obtained from raw measurements, including HTL/HTW, HCL/HTL.

Additional morphological data were also obtained from published literature (Malnate 1962; Zhao et al. 1998; Zhao 2006; Yang et al. 2008).

Molecular analysis

Sequences of 39 specimens of 20 species were obtained from GenBank (Table 1). Liver or muscle tissue of new specimens collected from fieldwork is preserved in 95% ethanol. Genomic DNA was extracted using a commercially-available DNA extraction kit (Sangon Biotech Co., Ltd.).

Table 1.
Download as
CSV
XLSX

DNA sequences used in this study.

Taxon Voucher number Locality GenBank accession number Reference
Cyt b C-mos NT3 Rag1
Hebius atemporalis HS 11001 (CHS 153) Mengzi, Yunnan, China MK201299 – – MK194367 Li et al. (2020)
Hebius atemporalis GP 1626 Guangdong, China KJ685680 KJ685630 KJ685732 KJ685572 Guo et al. (2014)
Hebius boulengeri SYS r001506 (CHS 757) Dawuling, Guangdong, China MK201509 – – – Li et al. (2020)
Hebius boulengeri RE55 (CHS 291) Chebaling, Guangdong, China MK201380 – – MK194448 Li et al. (2020)
Hebius boulengeri GP 1789 Guangdong, China KJ685684 KJ685634 KJ685736 KJ685576 Guo et al. (2014)
Hebius clerki CAS 215036 Yunnan, China KJ685666 KJ685615 KJ685716 KJ685559 Guo et al. (2014)
Hebius concelarus KUZ: R20253 (AB 989268) Miyakojimashi, Japan AB989268 AB989271 LC047778 LC047774 Kaito and Toda (2016)
Hebius concelarus KUZ: R20255 (AB 989272) Miyakojimashi, Japan AB989272 – – – Kaito and Toda (2016)
Hebius craspedogaster GP 139 Sichuan, China JQ687437 JQ687429 KJ685730 KJ685569 Guo et al. (2014)
Hebius craspedogaster HS 13020 (CHS 155) Huangshan, Anhui, China MK201301 – – MK194369 Li et al. (2020)
Hebius craspedogaster SYS r000910 (CHS 602) Huangshan, Anhui, China MK201428 – – MK194505 Li et al. (2020)
Hebius igneus AMNH 148575 Ha Giang, Vietnam KJ685665 KJ685614 KJ685715 KJ685558 Guo et al. (2014)
Hebius ishigakiensis KUZ: R33044 Iriomotejima, Japan AB989294 – – – Kaito and Toda (2016)
Hebius ishigakiensis KUZ: R33045 Iriomotejima, Japan AB989296 – – – Kaito and Toda (2016)
Hebius johannis GP 1569 Yunnan, China KJ685678 KJ685628 KJ685731 KJ685571 Guo et al. (2014)
Hebius johannis GP 897 Yunnan, China KJ685708 KJ685658 KJ685767 KJ685605 Guo et al. (2014)
Hebius khasiensis CAS 221504 Kachin, Myanmar KJ685668 KJ685617 KJ685718 KJ685561 Guo et al. (2014)
Hebius khasiensis CAS 221525 Kachin, Myanmar KJ685669 KJ685618 KJ685719 KJ685562 Guo et al. (2014)
Hebius metusia HS 11158 (CHS 152) Pingshan, Yibin, Sichuan, China MK201298 – – MK194366 Li et al. (2020)
Hebius metusia GP 871 Sichuan, China KJ685707 KJ685657 KJ685766 – Guo et al. (2014)
Hebius metusia GP 1712 Sichuan, China KJ685682 KJ685632 KJ685734 KJ685574 Guo et al. (2014)
Hebius modestus CAS 234262 Yunnan, China KJ685671 KJ685620 KJ685721 KJ685564 Guo et al. (2014)
Hebius optatus HS 11143 (CHS 151) Mangshan, Hunan, China MK201297 – – MK194365 Li et al. (2020)
Hebius optatus GP 1885 Guizhou, China KJ685687 KJ685637 KJ685739 KJ685579 Guo et al. (2014)
Hebius optatus AMNH 147155 Vinh Phu, Vietnam KJ685662 KJ685611 KJ685712 KJ685555 Guo et al. (2014)
Hebius popei GP 2169 Hainan, China KJ685692 KJ685642 KJ685744 KJ685584 Guo et al. (2014)
Hebius popei GP 2386 Guizhou, China KJ685697 KJ685647 KJ685749 KJ685588 Guo et al. (2014)
Hebius pryeri KUZ: R67983 Amamioshima, Japan AB989102 AB989105 LC047779 LC047776 Kaito and Toda (2016)
Hebius sangzhiensis SYNU 08070350 Sangzhi, Hunan, China MK340763 – – – Zhou et al. (2019)
Hebius sauteri CIB 118516 Guangdong, China OP937178 OP965807 OP965801 OP965796 This study
Hebius sauteri SYS r001766 Hunan, China OP937182 OP965802 OP965797 OP965792 This study
Hebius sauteri SYS r001258 Jiangxi, China OP937180 OP965805 OP965799 OP965794 This study
Hebius sauteri SYS r001266 Jiangxi, China OP937181 OP965804 OP965798 OP965793 This study
Hebius sauteri GP 1790 Guangdong, China KJ685685 KJ685635 KJ685737 KJ685577 Guo et al. (2014)
Hebius sauteri GP 2549 Taiwan, China KJ685701 KJ685651 KJ685754 KJ685592 Guo et al. (2014)
Hebius sauteri CIB 118517 Fujian, China OP937179 OP965806 OP965800 OP965795 This study
Hebius sauteri SYS r002087 Hunan, China OP937183 OP965803 – – This study
Hebius maximus HS 11157 (CHS 156) Mianyang, Sichuan, China MK201302 – – MK194370 Li et al. (2020)
Hebius maximus GP 864 Sichuan, China KJ685706 KJ685656 KJ685765 KJ685603 Guo et al. (2014)
Hebius maximus GP 2382 Sichuan, China KJ685696 KJ685646 KJ685748 – Guo et al. (2014)
Hebius maximus CIB 118518 Dayi, Sichuan, China OP937186 OP937189 OP937192 OP965791 This study
Hebius maximus SYS r002041 Bijie, Guizhou, China OP937184 OP937190 OP937191 OP965790 This study
Hebius maximus CIB 118072 Bijie, Guizhou, China OP937188 – – – This study
Hebius maximus CIB 118074 Bijie, Guizhou, China OP937187 – – – This study
Hebius maximus CIB 118635 Yibin, Sichuan, China OP937185 – – – This study
Hebius vibakari KUZ: R21587 Kyoto, Japan AB989302 AB989305 – – Kaito and Toda (2016)
Hebius vibakari HS 14026 (CHS 149) Harbin, China MK201296 – – MK194363 Li et al. (2020)
Hebius vibakari GP 1352 Heilongjiang, China KJ685677 KJ685627 KJ685729 KJ685568 Guo et al. (2014)
Hebius yanbianensis GP 4006 Yanbian, Sichuan, China MH532291 – – – Liu et al. (2018)
Herpetoreas tpser JK 201710 (CHS 849) Mêdog, Tibet, China MK201567 – – – Li et al. (2020)

A single mitochondrial gene (mitochondrial cytochrome b, Cyt b) and three nuclear genes (oocyte maturation factor mos, C-mos; recombination-activating gene 1, Rag1; neurotrophin 3, NT3) were amplified by using polymerase chain reaction (PCR), primers used in amplification are listed in Table 2. PCR cycling and running program of Cyt b is performed as a denaturing step at 94 °C for 7 min; followed by 40 cycles of 94 °C for 40 s, 46 °C for 30 s, and 72 °C for 1 min; and a final extension step at 72 °C for 8 min. The cycling and running program for C-mos, Rag1, and NT3 amplification followed Kelly (2011), Kaito and Toda (2016). PCR products were purified and then sequenced in both directions by Sangon Biotech Co., Ltd. (Shanghai, China). Sequences alignment and calculation of the uncorrected pairwise distance (p-distance) were conducted by using MEGA X (Kumar et al. 2018). Four gene sequences were concatenated in PhyloSuite v1.2.2 (Zhang et al. 2020).

Table 2.
Download as
CSV
XLSX

Primers used for DNA amplification.

Gene Primers Primer sequences (from 5’ to 3’) Reference
Cyt b L14919 AACCACCGTTGTTATTCA ACT Burbrink et al. (2000)
H16064 CTTTGGTTTACAAGA ACAATGCTTTA
C-mos S77 CATGGACTGGGATCAGTTATG Lawson et al. (2005)
S78 CCTTGGGTGTGATTTTCTCACCT
Rag1 R13 TCTGAATGGAAATTCAAGCTGTT Groth and Barrowclough (1999)
R18 GATGCTGCCTCGGTCGGCCACCT TT
NT3 NT3F ATATTTCTGGCTTTTCTCTGTGGC Noonan and Chippindale (2006)
NT3R GCGTTTCATAAAAATATTGTTTGACCGG

The best model of sequence evolution for Maximum Likelihood (ML) and Bayesian inference (BI) analysis were selected using PartitionFinder v2.1.1 (Lanfear et al. 2016). The best evolution model for concatenated sequences is TIM+I+G for Rag 1, C-mos, NT3, and GTR+I+G for Cyt b. MrBayes ver. 3.2.6 (Stamatakis 2014) was used for the BI analyses, searches were conducted with three independent runs, each run started with a random tree, set as four Markov chain Monte Carlo (MCMC) iterated for 10 million generations and sampled every 100 generations. The first 25% of all searched trees were discarded as burn-in. Bayesian posterior probability (BPP) ≥ 95% is regarded as strongly supported. RAxML ver. 8.2.1 (Ronquist and Huelsenbeck 2003) was used to search for the best maximum likelihood tree with 1000 bootstraps. Herpetoreas tpser was chosen as the outgroup.

Collection abbreviations

NHMUK: The Natural History Museum [formerly British Museum (Natural History)], London, England, UK; CIB: Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, China; CAS: California Academy of Sciences, San Francisco, USA; FMNH: Field Museum of Natural History, Chicago, Illinois, USA; SYS: The Museum of Biology, School of Life Sciences, Sun Yat-Sen University, Guangzhou, China; USNM: National Museum of Natural History (formerly United States National Museum), Smithsonian Institution, Washington, District of Columbia, USA; YBU: Yibin University, Yibin, China.

Results

Phylogeny

Aligned sequences concatenation is 3,087 bp in length (Cyt b = 1,070 bp; C-mos = 587 bp; NT3 = 476 bp; Rag1 = 954 bp). The topological structure of the phylogenetic tree (Fig. 1) was largely consistent with previous studies (Guo et al. 2014; Kizirian et al. 2018; Liu et al. 2018; Zhou et al. 2019). Although higher relationships of Hebius congeners remain not fully resolved, the phylogenetic relationships of our targeted species were strongly supported. In both BI and ML phylogenetic trees, H. s. maximus and H. s. sauteri formed two well-supported (BS = 100, BPP = 1.00) clades, and the two subspecies were paraphyletic with respect to recognized species (including H. vibakari, H. sangzhiensis, H. ishigakiensis, and H. pryeri, and H. concelarus; Fig. 1).

Figure 1. 

Maximum likelihood (ML) tree of the genus Hebius based on Cyt b, NT3, C-mos and Rag1, showing phylogenetic position of Hebius sauteri (blue) and Hebius maximus comb. nov. (green).

The uncorrected pairwise distance of Cyt b sequences between H. s. maximus and H. s. sauteri varies from 12.05 to 12.65% (Table 3), which is higher than the overall mean distance of selected taxa apart from Hebius clade (12.1%) (Ren et al. 2018).

Table 3.
Download as
CSV
XLSX

Uncorrected p-distance between Hebius species based on 1070 base pairs from the mitochondrial genes Cyt b.

Number Species Voucher 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
1 Hebius atemporalis GP 1626
2 Hebius concelarus KUZ: R20255 0.174
3 Hebius craspedogaster GP 139 0.152 0.164
4 Hebius igneus AMNH 148575 0.155 0.174 0.168
5 Hebius ishigakiensis KUZ: R33044 0.136 0.133 0.159 0.159
6 Hebius metusia GP 871 0.131 0.150 0.131 0.143 0.136
7 Hebius optatus AMNH 147155 0.145 0.144 0.157 0.163 0.131 0.136
8 Hebius pryeri KUZ: R67983 0.153 0.093 0.171 0.176 0.117 0.139 0.151
9 Hebius sangzhiensis SYNU 08070350 0.151 0.132 0.152 0.162 0.123 0.139 0.139 0.120
10 Hebius sauteri CIB 118516 0.138 0.151 0.143 0.162 0.123 0.119 0.120 0.141 0.132
11 Hebius sauteri SYS r001258 0.136 0.151 0.139 0.162 0.125 0.117 0.120 0.137 0.133 0.009
12 Hebius sauteri CIB 118517 0.124 0.139 0.138 0.158 0.115 0.110 0.112 0.132 0.126 0.030 0.029
13 Hebius maximus CIB 118518 0.133 0.157 0.133 0.144 0.125 0.124 0.124 0.139 0.082 0.125 0.126 0.116
14 Hebius maximus CIB 118072 0.133 0.154 0.136 0.150 0.122 0.134 0.122 0.139 0.084 0.123 0.124 0.116 0.007
15 Hebius maximus CIB 118635 0.139 0.151 0.137 0.150 0.128 0.136 0.125 0.136 0.085 0.124 0.125 0.117 0.007 0.007
16 Hebius yanbianensis GP 4006 0.130 0.152 0.139 0.150 0.134 0.057 0.141 0.135 0.126 0.126 0.124 0.120 0.119 0.125 0.129

Morphology

Specimens of H. s. maximus from Sichuan and Guizhou Provinces in southwestern China largely agree with the original description of H. s. maximus as follows (data from the original description in parenthesis): ventrals 132–143 (vs. 137–141); SpL 7–8 (vs. 7); IfL 7–9 on both sides of the head, IfL 1–3, 1–4, or 1–5 border the anterior chin-shields (vs. IfL 8/9, IfL 1–4 in contact with the anterior chin-shields); 2 preoculars in two specimens, on both sides in CIB 8484, on the right side only in CIB 8467 (vs. 1); postocular 2–3 (vs. 2); anterior temporals 1–2 (vs. 2) (Malnate 1962). Thus, we confirm the identity of the sampled population as the subspecies H. s. maximus in this study.

Although superficially similar to H. s. sauteri, H. s. maximus can be distinguished from H. s. sauteri by having a higher number of ventrals (132–138 in males, 135–143 in females in H. s. maximus vs. 125–130 in males, 116–133 in females in H. s. sauteri), a higher number of ventrals + subcaudals (207–225 in H. s. maximus vs. 187–212 in H. s. sauteri), and a different coloration of infralabials (usually white with black edge on the posterior part of 1st–3rd IfL only in H. s. maximus vs. white with black edge between each IfL in H. s. sauteri) (Table 4, 5; Fig. 3).

Table 4.
Download as
CSV
XLSX

Morphological characters of H. maximus and H. sauteri. For specimens with asymmetrical cephalic scales, the scale count was given as “left/right”, “–” indicates missing data.

Species Voucher number Locality Sex ToL (mm) TL (mm) SpL IfL PtO DSR V SC V+SC MT
H. maximus CIB 118635 Sichuan, China M 470 141 3-2-3 8 3 17-17-17 138 87+1 225 22+2
H. maximus CIB 118518 Sichuan, China M 433 137+? – – 2 17-17-17 137 74+? – –
H. maximus CIB 8482 Guizhou, China M 352 117 3/2-2-2 7/8 2 17-17-17 136 83+1 219 –
H. maximus YBU 18170 Sichuan, China M 260 66 2-2-3 9 3/2 17-17-17 137 72+1 209 22+2
H. maximus YBU 11258 Chongqing, China M 365 111 2-2-3 7 2/3 17-17-17 133 92+1 225 22+2
H. maximus CIB 118072 Guizhou, China F 384 106 3/2-2-3 7/8 3 17-17-17 141 73+1 214 –
H. maximus CIB 107649 Sichuan, China F 496 131 2-2-3 8 2/3 17-17-17 135 73+1 208 –
H. maximus CIB 8484 Guizhou, China F 300 70 2-2-3 8 3/2 17-17-17 143 64+1 207 –
H. maximus CIB 8470 Sichuan, China F 333 93 2/3-3/2-3 7 2 17-17-17 135 72+1 207 –
H. maximus CIB 94216 Sichuan, China F 523 162 3-2-3 8 2/3 17-17-17 135 82+1 217 –
H. sauteri SYS r001766 Hunan, China M 320 96 2-2-3 7/8 3/2 17-17-17 128 76+1 204 24+2
H. sauteri SYS r001266 Jiangxi, China M 282 88 2-2-3 8 2/3 17-17-17 129 84+1 213 23+2
H. sauteri CIB 8481 Hainan, China M 347 95 3/2-2-? /2 -/8 3 17-17-17 125 74+1 199 –
H. sauteri CAS 18984 Taiwan, China F 303 99 2-2-3 7 3 17-17-17 116 71+1 187 –
H. sauteri CAS 18988 Taiwan, China – 299 83 2-2-3 7 3 17-17-17 128 77+1 205 –
H. sauteri YBU 17001 Hainan, China F 225 58 2-2-3 7 3 17-17-17 126 76+1 202 25+2
H. sauteri CIB 118517 Fujian, China F 412 120 2-2-3 8 2/3 17-17-17 133 79+1 212 24+3
H. sauteri CIB 118516 Guangdong, China F 324 88 2-2-3 7 3 17-17-17 129 69+1 198 –
H. sauteri SYS r001150 Guangdong, China F 145 38 2-2-3 7 3 17-17-17 129 70+1 199 21+2
H. sauteri SYS r000275 Guizhou, China F 306 77 2-2-3 7 3/2 17-17-17 132 66+? – –
Table 5.
Download as
CSV
XLSX

Comparison of main morphological characters of H. maximus, H. s. sauteri, “–” indicates missing data.

Species TL/ToL V SC V + SC MT
Male Female Male Female Male Female Male Female Male Female
H. maximus 0.25–0.33 (0.29 ± 0.02) 0.25–0.31 (0.27 ± 0.02) 132–138 (136 ± 2) 135–143 (138 ± 3) 72–92 (81 ± 6) 64–82 (72 ± 5) 209–225 (216 ± 6) 207–217 (210 ± 3) 24 –
H. s. sauteri 0.27–0.31 (0.30 ± 0.02) 0.24–0.33 (0.28 ± 0.02) 125–130 (128 ± 2) 116–133 (129 ± 4) 74–84 (78 ± 4) 69–86 (74 ± 5) 199–213 (205 ± 6) 187–215 (203 ± 7) 25–27 23–27

Consequently, all available data support the recognition of H. s. maximus as a distinct species rather than a subspecies of H. sauteri. Herein, we elevate the subspecies H. s. maximus to a full species status, i.e., Hebius maximus (Malnate 1962) comb. nov. Furthermore, based on historical collections and newly collected specimens, we provide an expanded morphological description of both H. s. sauteri and H. maximus comb. nov.

Taxonomic accounts

Hebius sauteri (Boulenger, 1909)

Figs 2, 3, 4, 5, 6

Tropidonotus sauteri Boulenger, 1909, Ann. Mag. Nat. Hist., London. ser.8, 4, 495. Type locality: Kosempo (= Chiahsien, Kaohsiung County), Taiwan, China.

Natrix sauteri — Mell 1931 [1929]: 204; Moichiro 1931: 30; Bourret 1934a: 4; Bourret 1935: 2; Pope 1935: 125 (in part); Smith 1943: 287.

Amphiesma sauteri — Malnate 1960: 51; Zhao and Adler 1993: 228 (in part); Xie et al. 1998: 82; Zhao et al. 1998: 80 (in part); Orlov et al. 2000: 72; David et al. 2007: 60 (in part); Nguyen et al. 2009: 357; Xiang et al. 2012: 230; Wallach et al. 2014: 33 (in part).

Amphiesma sauteri sauteri — Malnate 1962: 272.

Amphiesma sauteri bourreti — Malnate 1962: 273.

Natrix copei Van Denburgh 1909, Proc. California Acad. Sci. 3(3): 52–53. Type locality: “Kanshirei, Formosa” (= Guanziling, Tainan County, Taiwan, China)

Types

Syntypes . NHMUK (formerly BMNH) 1946.1.13.38–39, a male and a female.

Referred specimens

19 specimens of H. s. sauteri were examined in this study: CHINA (n = 19) – Taiwan Prov. CAS 18984, Pingtung County; CAS 18988 (paratype of Natrix copei Van Denburgh, 1909), Tainan City, Guanziling. – Fujian Prov. CIB 8476–8479, CIB 78046, Dehua County, Daiyun; CIB 118517, Dehua County, Xinyong Village; CIB 8480, Wuyishan City, Xingcun Township. – Anhui Prov. CIB 8483, Huangshan City. – Jiangxi Prov. SYS r000323, Jinggangshan City, Mt. Jinggang; SYS r001258, SYS r001266, Longnan County, Jiulianshan. – Hainan Prov. YBU 17001, Ledong Li Autonomous County, Jianfengling; CIB 8481. – Guangdong Prov. SYS r001150, Xinyi City, Sihe Township; CIB 118516, Dongguan City, Yinpingshan. – Guizhou Prov. SYS r000275, Libo County, Maolan National Natural Reserve. – Hunan Prov. SYS r001766, Guidong County, Bamianshan.

Diagnosis

Hebius sauteri can be distinguished from its congeners by the following features: (1) body size small to medium, maximum ToL 455 mm; (2) dorsal scales rows 17-17-17, all weekly keeled or smooth on outmost one or two rows; (3) ventral scales 116–133, subcaudals 60–86, paired; (4) maxillary teeth 23–27, last two or three distinctly enlarged teeth, without diastema; (5) preocular single, occasionally two; (6) supralabials 6–8, 2nd or 2nd–3rd border the loreal; (7) infralabials 6–9, mostly edged with black on their posterior border; (8) single white to orange stripe extends from angulus oris to neck; (9) dorsal body brown to reddish brown, with or without single series of white spots or short band on lateral.

Description

Head moderately distinct from neck; body size small to medium, ToL 145–455 mm (282–370 mm in males, 145–455 mm in females), TL/ToL 0.24–0.33 (0.27–0.31 in males, 0.24–0.33 in females). Eye large, pupil round.

Dentition. Maxillary teeth 23–27 without diastema, gradually enlarged posteriorly, last two or three distinctly enlarged.

Body scalation. Body scale in 17-17-17 rows, weekly keeled except outer 1–4 rows smooth anteriorly, outer 0–2 rows smooth at midbody and outer 0–1 row smooth posteriorly; ventrals 116–133 (125–130 in males, 116–133 in females); subcaudals 60–86 (60–86 in females, 65–84 in males), paired.

Head scalation. Rostral broad, visible from above; internasals paired, nearly triangular, curved outwards, not in contact with loreal; prefrontals paired, nearly in a diamond shape, wider than long, border on loreal laterally, preocular and supraocular posteriorly; frontal hexagonal, longer than wide, embedded into parietal posteriorly; parietal paired, much longer than wide; nasals wider than high, divided below nostril, borders 1st–2nd supralabials; loreal single, rarely divided (right side of CIB 8481), borders 2nd or 2nd–3rd supralabials, not entering orbit; preocular 1–2; supraocular single, narrowed anteriorly, much wider than high, not in contact with parietal; postoculars 2–3, rarely 4 (left side of CIB 8483); supralabials 6–8, 5th, 6th or 7th highest, 3rd –4th entering orbit, rarely 2nd–3rd (right side of CIB 8480), 3rd only (both sides of CIB 8479) or 4th–5th (left side of CIB 8477); infralabials 6–9, first pair in contact behind the mental, IfL 1–3, 1–4 or 1–5 border the anterior chin shields; temporals variable, in two or three rows, 1–2 + 1–3 + 0/2–3; chin shields paired, posterior pair longer (Figs 3, 5, Table 4).

Hemipenis. The description of the hemipenis is based on an adult specimen (SYS r000323) from Mt. Jinggang, Jiangxi, southeastern China. Left side of hemipenis fully everted, right side remained in situ for description of retracted condition.

The everted hemipenis is thin and short, Y-shaped, shallowly bilobed. Both sulcate and asulcate surfaces densely ornamented with spinules, a large basal hook present at proximal part. Sulcus spermaticus single, extending to base of inner right lobe where it takes a centripetal position. Sulcus lip highly developed and raised, walls covered with spinules (Fig. 6).

In situ hemipenis extends to 7th SC with its crotch extending to 6th SC; crotch of m. retractor penis magnus extending to 8th SC, origin of m. retractor penis magnus at level of 20th SC.

Coloration in life

Based on two adult female specimens from Guangdong (CIB 118516) and Fujian (CIB 118517), China. Dorsal surface of the head reddish-brown with irregular grayish-green spots, a pair of elliptic orangish spots symmetrically present on inner sides of parietals, just separated by parietal sutures; ventral side of head whitish; 1st–5th supralabials white with black edges posteriorly, 6th or 6–7th brown on their upper part; infralabials white with black edge between each scale; an orange stripe extends from angulus oris to dorsal side of neck, 1–2 scales wide; dorsal surface of body and tail dark brown to reddish-brown, top with or without an ill-defined dark olive stripe scattered with black spots extends from neck to the end, a reddish-brown lateral streak on 4th–6th body scale rows extends from neck to tail with series of orange spots separated by 2–3 scales above; ventral and subcaudal sides cream white, with black spots on both ends of the ventral scale forming a chain-like pattern on the ventral view; sclera brown (Fig. 4).

Figure 2. 

Distribution of Hebius maximus comb. nov. and re-defined distribution of H. sauteri in China based on museum collections, previous studies, and this study (Triangle: Hebius maximus comb. nov., round: H. sauteri sauteri, square: H. sauteri bourreti. Type localities are colored red).

Figure 3. 

Dorsal (left), lateral (middle) and ventral (right) of the head comparisons between Hebius sauteri and Hebius maximus comb. nov. Row D photographed by Kai Wang, others were photographed by Jun-Jie Huang. A–C. Hebius maximus comb. nov. (A. CIB 118635, Mt. Laojun, Pingshan County, Sichuan, China; B. CIB 8482, Bijie City, Guizhou, China; C. CIB 8458, Yingjing County, Sichuan, China) D–F. H. sauteri (CAS 18984, Pingtung County, Taiwan, China; CIB 118516, Yinpingshan, Dongguan City, Guangdong, China; CIB 118517, Daiyun, Dehua County, Fujian, China).

Figure 4. 

Hebius sauteri. A. CIB 118516, Yinpingshan, Dongguan City, Guangdong, China; B. CIB 118517, Xinyong Village, Dehua County, Fujian, China. Photographs by Jin-Long Ren.

Figure 5. 

Preserved specimen of H. sauteri (CAS 18988), from the type locality of the species, Guanziling, Tainan City, Taiwan, China. Not to scale. Photographs by Kai Wang.

Figure 6. 

Photographs of the hemipenis of H. sauteri (SYS r000323, Mt. Jinggang, Jiangxi Province, China), photos from left to right showing sulcate, asulcate, and apical sides of the hemipenis. Photographs by Jun-Jie Huang.

Coloration in preservative

Largely the same as in life except dorsal side of head brown to dark brown, scattered with small black spots; ventral side of head cream white; a pale yellow stripe extends from angulus oris to dorsal side of neck, 1–2 scales wide; dorsal of body and tail brown to dark brown, a lighter lateral streak on 4th–6th body scale rows presents or not, covered with series of cream white spots separated by 2–3 scales; ventral and subcaudal sides cream to pale white; sclera black (Figs 3, 5).

Etymology

Hebius sauteri was named after the collector of the type specimens, Hans Sauter (1871–1943), a German naturalist (Boulenger 1909). We suggest that the Chinese common name of this species remains unchanged, as “Zōng Hēi Fù Liàn Shé (棕黑腹链蛇)”.

Natural history

This species inhabits flatlands and mountain regions up to 1,500 m and prefers terrestrial microhabitat such as grassland, woodland, and bushes near water bodies; diurnal, occasionally found at night, preys include earthworms, slugs, snails and tadpoles; oviparous (this study; Pope 1935; Zhao 2006; Xiang et al. 2009).

Distribution

Hebius sauteri is currently known to be reported in Vietnam (Ngan Son, Lang Son, Tam Dao and Ba Vi), and China, including Taiwan (Kaohsiung County [type locality]), Fujian (Dehua County), Anhui (Huangshan County), Jiangxi (Jinggangshan City, Longnan County), Hunan (Yizhang County), Guangdong (Lianping County, Xinyi County, Deqing County, Ruyuan County, Dongguan City), Guangxi (Jinxiu County, Quanzhou County, Rongxian County, Beiliu County, Long’an County), Guizhou (Libo County, Leishan County), Yunnan (Jinping County), Hainan (Qiongzhong County, Wuzhishan County, Baisha County, Lingshui County) (Deuve 1970; Wu 1985; Zhao 2006; Yang et al. 2008; Nguyen et al. 2009; Zhang 2009; Li 2011; Shen 2014; this study) (Fig. 2).

Remarks

Natrix copei (Van Denburgh, 1909) was described by Van Denburgh (1909) based on specimen form “Kanshirei” (now Guanziling), Tainan County, Taiwan Province, China, the description of this species was published just 20 days after that of Tropidonotus sauteri by Boulenger (1909) (now Hebius sauteri) (Stejneger 1910), Stejneger (1910) considered Natrix copei a synonym of Natrix sauteri. We examined the paratype of Natrix copei, and its morphological characters are in the range of variation of H. sauteri, which also supports the treatment of Natrix copei as an objective synonym by Stejneger (1910). The taxonomic status of the subspecies H. s. bourreti is discussed below.

Hebius maximus (Malnate, 1962), comb. nov.

Figs 2, 3, 7, 8, 9, 10, 11

Amphiesma sauteri maximus Malnate, 1962, Proc. Acad. Nat. Sci. Philadelphia, 114, 251–299. Type locality: “Hsaioyangchi, Szechwan, China.” (= Xiaoyangxi, Mabian Yi Autonomous County, Leshan City, Sichuan Province, China)

Natrix sauteri — Pope 1935: 125 (in part); Wu 1985: 209 (in part).

Amphiesma sauteri maximus — Malnate 1962: 272.

Amphiesma sauteri — Inger et al. 1990: 20; Zhao and Adler 1993: 228 (in part); Zhao et al. 1998: 80 (in part); Zhao 2003: 140; David et al. 2007: 60 (in part); Wallach et al. 2014: 33 (in part).

Hebius sauteri — Guo et al. 2014: 428 (in part); David et al. 2021 (in part).

Types

Holotype. FMNH 18796 (formerly CHNM 18796), a 457 mm adult female specimen (Fig. 7). Paratypes. FMNH 18797, USNM 71570, USNM 84362.

Figure 7. 

Holotype of Hebius maximus comb. nov. (FMNH 18796), photographs from Field Museum of Natural History (https://collections-zoology.fieldmuseum.org/catalogue/1846011).

Referred specimens

25 specimens of H. maximus were examined in this study: CHINA (n = 25) – Sichuan Prov. CIB 118635, Pingshan County, Mt. Laojun near the type locality; CIB 8451–8452, CIB 8455, CIB 8464, CIB 8467, CIB 8470–8471, Emeishan City, Mt. Emei; CIB 8458, Yingjing County; CIB 8457, Hongya County; CIB 118518, CIB 107645–646, CIB 107649, Dayi County; YBU 18170, Dujiangyan City; CIB 94215–94216, Mianyang City. – Chongqing. CIB 8448, Youyang Tujia & Miao Autonomous County; YBU 11258, Xiushan Tujia & Miao Autonomous County. – Guizhou Prov. CIB 8482, SYS r002041, CIB 8484, CIB 118072–118074, Bijie City, Qixingguan District.

Diagnosis

Hebius maximus comb. nov. can be distinguished from its congeners by the following morphological characters: (1) body size small to medium, maximum ToL 597 mm; (2) dorsal scales rows 17-17-17, all weekly keeled or smooth at outmost one or two rows; (3) ventral scales 132–143, cloacal plates divided, subcaudals 64–92, paired; (4) maxillary teeth 24, last two distinctly enlarged, without diastema; (5) supralabials 7–8; (6) infralabials 7–9, generally edged with black at posterior border on 1st–3rd scales only; (7) a light orange stripe extends from angulus oris to the neck; (8) dorsal body reddish brown or grayish brown, with an ill-defined dark olive streak scattered with black spots extending from neck to end at medium of the dorsal.

Description

Body elongated, small to medium-sized, ToL 175–597 mm (260–470 mm in males, 175–597 mm in females); tail relatively long, TL/ToL 0.25–0.33 (0.25–0.33 in males, 0.25–0.31 in females). Eye large, pupil round.

Dentition. Maxillary teeth 24, without diastema, gradually enlarged posteriorly, last two distinctly enlarged.

Body scalation. Dorsal scales in 17-17-17 rows, weekly keeled except outer 1–4 rows at anterior body, outer 0–2 rows smooth at midbody and outer 0–1 row smooth posteriorly; ventrals 132–143 (132–138 in males, 135–143 in females); cloacal plates divided; subcaudals 64–92 (72–92 in males, 64–82 in females), paired.

Head scalation. Rostral broad, visible from above; internasals paired, nearly triangular, curved outwards, not bordering loreal; prefrontals paired, nearly in a diamond shape, wider than long, borders the loreal, preocular, and supraocular; frontal hexagonal, longer than wide, embedded into parietals posteriorly; parietals paired, not bordering preocular; nasals wider than high, divided at lower half, borders 1st–2nd supralabials; loreal single, borders 2nd or 2nd–3rd supralabials, not entering orbit; preocular single, higher than wide, rarely divided (CIB 8484, CIB 8467, SYS r002041); supraocular single, narrowed anteriorly, much wider than high; postoculars 2–3; supralabials 7–8, 6th or 7th highest, 3rd–4th or 4th–5th entering orbit; temporals 1–2 + 1–3 + 0/2–4; infralabials 7–9, first pair in contact behind the mental, IfL 1–3, 1–4 or 1–5 border the anterior chin shields; chin shields paired, posterior pair longer (Figs 3, 8, Table 4).

Figure 8. 

Hebius maximus comb. nov. A. SYS r002041, adult male, Wujing, Bijie, Guizhou, China; B. CIB 118635, adult male, Mt. Laojun, Pingshan, Sichuan, China; C. adult female, Mt. Emei, Sichuan, China. Photographs by Zhi-Tong Lyu (A) and Mao-Liang Li (B, C).

Hemipenis. The description of hemipenis based on an adult specimen (CIB 118635) near the type locality, Yibin, Sichuan, southwestern China. The left side of hemipenis fully everted, whereas the right side remained in situ for description of retracted condition.

Hemipenis thin and short, hemipenial total length (HTL) 7.14 mm, hemipenial total width (HTW) 1.57 mm. HTL/HTW 4.55; Y-shaped, shallowly bilobed, hemipenial truncus length (HCL): 5.75 mm, HCL/HTL 0.81. Both sulcate and asulcate surfaces densely ornamented with spinules, a large basal hook present at the proximal part. Sulcus spermaticus single, extending to base of inner right lobe where it takes a centripetal position. Sulcus lip highly developed and raised, walls covered with spinules (Fig. 10).

In situ hemipenis extends up to 5th SC with its crotch extending to 4th SC; crotch of m. retractor penis magnus extending to 6th SC, origin of m. retractor penis magnus invariably at level of 20th SC.

Coloration in life

Based on one male adult specimen near the type locality (CIB 118635). Dorsal side of head reddish brown with irregular dark and olive spots above; ventral side of head cream white; 1st–6th supralabials whitish with dark edges on posterior part; 7th supralabial reddish-brown at upper part and white with dark edge at lower part, 8th supralabial cream white, gradually turning to orange posteriorly; infralabials white, edged with black on posterior border on 1st–3rd scales only; an orange stripe extends from angulus oris to dorsal side of neck, two scales wide; dorsal body and tail reddish-brown with an ill-defined dark olive dorsal streak scattered with black spots extending from neck to tail, lateral with a series of orange spots separated by 2–3 scales on 4th–5th body scale rows, gradually faded posteriorly; ventral and subcaudal cream white with black spots on outer edge of each scale; sclera yellow with black round pupil (Fig. 8).

Coloration in preservative

Largely the same as in life except dorsal head brown to seal brown, with or without irregular dark spots; supralabials cream white to pale gray, 1st–6th supralabials with black edge or spots posteriorly, upper half of the highest supralabial brown to black; a pale orange to yellow short stripe extends from angulus oris to neck; dorsal of body and tail brown to seal brown, slightly darker posteriorly, with or without a series of white spots or short band separated by 2–3 scales on 4–6 body scale rows; ventral and subcaudal cream white to pale grey; sclera black (Fig. 9).

Figure 9. 

Preserved specimen of Hebius maximus comb. nov., CIB 118635, adult male near the type locality of the species, Mt. Laojun, Pingshan Country, Sichuan, China. Photographs by Jun-Jie Huang.

Figure 10. 

Photographs of the hemipenis of Hebius maximus comb. nov., CIB 118635, Mt. Laojun, Pingshan, Sichuan, China, photos from left to right showing sulcate, asulcate, and apical sides of the hemipenis. Photographs by Jun-Jie Huang.

Sexual dimorphism

Males H. maximus comb. nov. exhibit a lower number of ventral scales [132–138 (136 ± 2) in male vs. 135–143 (138 ± 3) in female] and a higher number of subcaudal scale counts [72–92 (81 ± 6) in male vs. 64–82 (72 ± 5) in female] than female (n = 13 male and 12 female) (Tables 4, 5).

Comparison

Hebius maximus comb. nov. differs from H. andreae, H. annamensis, H. arquus, H. beddomei, H. bitaeniatus, H. boulengeri, H. celebicus, H. clerki, H. concelarus, H. craspedogaster, H. deschauenseei, H. flavifrons, H. groundwateri, H. igneus, H. inas, H. ishigakiensis, H. johannis, H. kerinciensis, H. khasiensis, H. lacrima, H. leucomystax, H. metusia, H. miyajimae, H. modestus, H. monticola, H. nicobariensis, H. octolineatus, H. optatus, H. parallelus, H. petersii, H. popei, H. pryeri, H. sangzhiensis, H. sanguineus, H. sarasinorum, H. septemlineatus, H. vibakari, H. viperinus, H. weixiensis, H. xenura and H. yanbianensis by having 17-17-17 dorsal scale rows vs. 19-19-17 rows.

Hebius maximus comb. nov. differs from H. chapaensis, H. frenatus, H. nigriventer, H. sarawacensis and H. taronensis by (1) maxillary teeth 24 vs. 29–34 in H. chapaensis, 28–33 in H. nigriventer, 28–32 in H. taronensis; (2) ventrals 132–143 vs. 159–177 in H. chapaensis, 164–166 in H. frenatus, 155–168 in H. nigriventer, 145–150 in H. sarawacensis, 158–176 in H. taronensis (Peters 1871; Malkmus et al. 2002; David et al. 2005; David et al. 2015; Purkayastha and David 2019; David et al. 2021).

Hebius maximus comb. nov. differs from H. atemporalis by (1) temporals present, supralabial not in contact with parietal vs. usually absent or a small triangular temporal between postocular and supralabial, supralabial in contact with parietal; (2) maxillary teeth 24 vs. 27–32 (Bourret 1934b; Zhao et al. 1998; Table 4).

Lastly, H. maximus comb. nov. was previously confused with H. sauteri, H. maximus differs from the latter species in having (1) more ventrals, 132–138 in male, 135–143 in female vs. 125–130 in male, 116–133 in female; (2) more ventrals + subcaudals counts, 207–225 vs. 187–215 (3) fewer maxillary teeth 24 vs. 23–27 (Zhao et al. 1998; this study); (4) infralabials white edged with black at the posterior border usually on 1st–3rd scales only vs. white with black edge between each scale (Fig. 3, Tables 4, 5).

Etymology

Hebius maximus comb. nov. is named for its highest count of ventral scales among three previous subspecies of H. sauteri (Malnate 1962). Since Hebius maximus comb. nov. is mainly distributed in southwestern China (Sichuan, Chongqing, and Guizhou), we suggest its common name as “Western China Keelback” in English and “Huá Xī Fù Liàn Shé (华西腹链蛇)” in Chinese.

Natural history

Hebius maximus comb. nov. inhabits subtropical mountain regions around 812–1,200 m above sea level, including coniferous forest and large forest clearings (Inger et al. 1990; This study). One specimen near the type locality (CIB 118635) was found on a road near a stream at dusk, emerging from a cornfield. The species is diurnal and is active at dusk; it has been reported to prey on earthworms, slugs, and tadpoles (Wu et al. 1985; Zhao 2006). Oviparous, Pope (1935) reported five well-developed eggs inside with very small embryos in one specimen (USNM 84362) from Chouchiakou (= Zhoujiakou), Suchow (= Yibin City), Sichuan, China, while Inger et al. (1990) reported two females collected from Washan, Sichuan had one enlarged egg in each ovary. The specimens of H. maximus comb. nov. we collected exhibit no tendency to bite when handled. Hebius maximus comb. nov. is found sympatric with Cyclophiops major, Achalinus spinalis, Protobothrops mucrosquamatus, Lycodon ruhstrati, Rhabdophis tigrinus, Sphenomorphus indicus, Rana omeimontis, Odorrana graminea and Bufo gargarizans in field observations during fieldwork conducted in Yibin, Sichuan, China (Fig. 11).

Figure 11. 

Natural habitat of Hebius maximus comb. nov. on Mt. Laojun, Pingshan, Yibin, Sichuan, China. A. Macrohabitat; B. Microhabitat. Photographs by Mao-Liang Li.

Distribution

Hebius maximus comb. nov. is currently known to be distributed in southwestern China, including Chongqing (Youyang Tujia & Miao Autonomous County, Xiushan Tujia & Miao Autonomous County), Sichuan (Mabian County, Pingshan County, Yingjing County, Hongya County, Dujiangyan City, Mianyang City, Leshan City) and Guizhou (Qixingguan District, Bijie City) (this study; Wu 1985) (Fig. 2).

Discussion

Taxonomic revision of Hebius maximus and Hebius sauteri

The Asian keelback snakes, genus Hebius, has long been considered difficult to identify due to the morphological resemblance among species, and H. maximus and H. sauteri were confused in the past six decades (Malnate 1962). Combining diagnostic morphological characters and molecular phylogeny, we elevated the previous subspecies H. s. maximus to full species status. Hebius maximus is currently known to be distributed in Sichuan, Chongqing, and Guizhou, China (Fig. 2). However, some previous records seem to be doubtful. For example, Yang et al. (2008) reported “H. s. maximus” from Kunming, Yunnan, southwestern China, based on a single specimen (Field number: No. 83017), whereas the number of maxillary teeth distinctly differs from the known range of H. maximus in having 35 maxillary teeth in No. 83017 vs. 24 in specimens from Sichuan. Thus, this record should be further studied in the future, and we doubt the distribution record of H. maximus from Yunnan, China. Consequently, we revised the distribution of H. sauteri and H. maximus, where H. sauteri is currently distributed in north Vietnam and southern China, including Taiwan Island and Hainan Island; while H. maximus is restricted in the mountain region of southwestern China (Fig. 2).

Despite the high resemblance between H. maximus and H. sauteri, which leads to great difficulty in species identification, H. sauteri and H. maximus are shown to be two distantly related clades (Fig. 1). Both species inhabit mountain regions and prey on earthworms, slugs, and tadpoles (Pope 1935; Wu 1985; Zhao et al. 1998; Zhao 2006). Combining with the phylogenetic relationships, it is supposed that this morphological resemblance may arise from convergent evolution, which should be discussed in further research (Wang et al. 2022).

Taxonomic status of Hebius sauteri bourreti

Three subspecies of Hebius sauteri were previously recognized based on the counts of ventral and subcaudal scales, i.e., H. s. sauteri, H. s. bourreti, and H. s. maximus. In the current study, H. s. maximus is recognized as a distinct species, i.e. Hebius maximus (see above). However, the taxonomic identity of the subspecies H. s. bourreti still remained elusive. The taxa H. s. bourreti was originally described by Malnate (1962) based on six specimens from Tam Dao, Vinh Phuc Province, northern Vietnam, which differs from the other two subspecies by having a fewer number of ventrals (123–130) than in H. s. sauteri (116–133) and in H. s. maximus (132–143), a fewer number of subcaudals (60–73) than in H. s. sauteri (69–86) and in H. s. maximus (64–92) and by the color pattern (supralabials posterior to the eye often in the form of a light, dark-edged stripe, continuous with the nuchal crescent; dorsal color dark brown; ventral pattern strongly developed, especially subcaudally).

Yang et al. (2008: 266) reported one specimen of H. s. bourreti from Adebo Town, Jinping County, Yunnan China (Fig. 2). No other specimen of H. s. bourreti has been recorded in China. Our extended examination of H. s. sauteri reveals that the body and head scale counts of H. s. bourreti are largely overlapping with the range of H. s. sauteri (Table 6), and the high variability of the color pattern of H. sauteri suggests coloration may be unreliable in identifying this subspecies. One specimen of H. s. sauteri (CIB 8480) from Fujian, China presents highly similar color pattern of H. s. bourreti in supralabials, dorsal, and ventral body; another specimen of H. sauteri (CIB 118516) from Guangdong, China also shows strong ventral pattern, which is similar to H. s. bourreti. Based on the comparisons discussed above, none of these morphology characters provided by Malnate (1962) could accurately distinguish H. s. bourreti from H. s. sauteri. Therefore, we suggest that H. s. bourreti is likely to be a synonym of H. s. sauteri which would make H. sauteri a monotypic species. More molecular evidence is needed to further confirm this suggestion.

Table 6.
Download as
CSV
XLSX

Morphological comparison of H. s. sauteri and H. s. bourreti.

Subspecies PrO PtO SpL IfL TEM V SC TL/ToL
H. s. sauteri 1–2 2–3 2(3)-2(1)-3(2) 6–9 1(2) + 1(2, 3) + 0(2, 3) 116–133 69–86 0.24–0.33
H. s. bourreti 1 2–3 2-2-3 7–8 1(2) + 1(2) 123–130 60–73 0.27–0.30

Acknowledgements

We thank Dr. Kai Wang (KIZ) for providing photos and morphological data. We thank Mr. Dihao Wu (CIB), Mr. Xiao Xiao, Mr. Junfeng Guo, and Mr. Haojun Chen for their help in the field and laboratorial work. This research was funded by the Second Tibetan Plateau Scientific Expedition and Research Program (STEP) (2019QZKK0501); the International Partnership Program of Chinese Academy of Sciences (151751KYSB20190024); Biological Resources Programme, Chinese Academy of Sciences (KFJBRP-017-65); the Key Research Program of Frontier Sciences, CAS (QYZDB-SSW-SMC058); the CAS “Light of West China” Program (2018XBZG_JCTD_001) and Talent Program from Organization Department of Sichuan Provincial Committee; the Project of Comprehensive Scientific Survey of Luoxiao Mountains Region of Ministry of Science and Technology, China (no. 2013FY111500); DFGP Project of Fauna of Guangdong-202115.

References

  • Boulenger GA (1909) Descriptions of four new frogs and a new snake discovered by Mr. H. Sauter in Formosa. The Annals and Magazine of Natural History 8(4): 492–495. https://doi.org/10.1080/00222930908692704
  • Bourret R (1934a) Notes herpétologiques sur l’Indochine française. II. Sur quelques serpents des montagnes du Tonkin. Bulletin Générale de l’Instruction Publique 13(8): 149–157. [in French]
  • Bourret R (1934b) Notes herpétologiques sur l’Indochine française. VI. Sur diverses collections de serpents appartenant à l’Université de Hanoi. Bulletin Générale de l’Instruction Publique 14(4): 73–83. [in French]
  • Bourret R (1935) Notes herpétologiques sur l’Indochine française. XI. Sur quelques serpents recoltés en 1934. Bulletin Générale de l’Instruction Publique 14(9): 289–296. [in French]
  • David P, Vogel G, Pauwels OSG (2005) On the occurrence of Amphiesma bitaeniatum (Wall, 1925) in Vietnam, with preliminary remarks on the group of Amphiesma parallelum (Boulenger, 1890) (Serpentes, Colubridae, Natricinae). Salamandra 41(4): 167–178
  • David P, Bain RH, Nguyen QT, Orlov N L, Vogel G, Vu T, Ziegler T (2007) A new species of the natricine snake genus Amphiesma from the Indochinese Region (Squamata: Colubridae: Natricinae). Zootaxa 1462: 41–60. https://doi.org/10.11646/zootaxa.1462.1.2
  • David P, Agarwal I, Athreya R, Mathew R, Vogel G, Mistry VK (2015) Revalidation of Natrix clerki Wall, 1925, an overlooked species in the genus Amphiesma Duméril, Bibron & Duméril, 1854 (Squamata: Natricidae). Zootaxa 3919(2): 375–395. https://doi.org/10.11646/zootaxa.3919.2.9
  • David P, Vogel G, Nguyen TQ, Orlov NL, Pauwels OSG, Teynié A, Ziegler T (2021) A revision of the dark-bellied, stream-dwelling snakes of the genus Hebius (Reptilia: Squamata: Natricidae) with the description of a new species from China, Vietnam and Thailand. Zootaxa 4911(1): 1–61. https://doi.org/10.11646/zootaxa.4911.1.1
  • Deuve J (1970) Serpents du Laos. Mémoirs O.R.S.T.O. M., Paris, 252 pp. [in French]
  • Groth JG, Barrowclough GF (1999) Basal divergences in birds and the phylogenetic utility of the nuclear RAG-1 gene. Molecular Phylogenetics and Evolution 12: 115–123. https://doi.org/10.1006/mpev.1998.0603
  • Guo P, Zhu F, Liu Q, Zhang L, Li JX, Huang YY, Pyron RA (2014) A taxonomic revision of the Asian keelback snakes, genus Amphiesma (Serpentes: Colubridae: Natricinae), with description of a new species. Zootaxa 3873(4): 425–440. https://doi.org/10.11646/zootaxa.3873.4.5
  • Hauser S, Smits T, David P (2022) On the distribution of the species of the genus Hebius Thompson, 1913 (Squamata: Natricidae) in northern Thailand, including the description of a new species and a discussion on snake diversity of this region. Zootaxa 5116(1): 1–39. https://doi.org/10.11646/zootaxa.5116.1.1
  • Hou SB, Yuan ZY, Wei PF, Zhao GG, Liu GH, Wu YH, Shen WJ, Chen JM, Guo P, Che J (2021) Molecular phylogeny and morphological comparisons of the genus Hebius Thompson, 1913 (Reptilia: Squamata: Colubridae) uncover a new taxon from Yunnan Province, China, and support revalidation of Hebius septemlineatus (Schmidt, 1925). Zoological Research 42(5): 620–625. https://doi.org/10.24272/j.issn.2095-8137.2021.093
  • Inger RF, Zhao EM, Shaffer HB, Wu GF (1990) Report on a collection of amphibians and reptiles from Sichuan, China. Fieldiana, Zoology [Series 2] (58): 1–24.
  • Jiang K (2010) A method for evaginating the hemipenis of preserved snake. Sichuan Journal of Zoology 29(1): 122–123. [in Chinese]
  • Kaito T, Toda M (2016) The biogeographical history of Asian keelback snakes of the genus Hebius (Squamata: Colubridae: Natricinae) in the Ryukyu Archipelago, Japan. Biological Journal of the Linnean Society 118: 187–199. https://doi.org/10.1111/bij.12726
  • Kelly CMR, Branch WR, Broadley DG, Barker NP, Villet MP (2011) Molecular systematics of the African snake family Lamprophiidae Fitzinger, 1843 (Serpentes: Elapoidea), with particular focus on the genera Lamprophis Fitzinger, 1843 and Mehelya Csiki, 1903. Molecular Phylogenetics and Evolution 58(3): 415–426. https://doi.org/10.1016/j.ympev.2010.11.010
  • Kizirian D, Truong NQ, Ngo HT, Le MD (2018) Parahelicops, Pararhabdophis, paraphyly: phylogenetic relationships among certain southeast asian natricine snakes (Hebius). American Museum Novitates 3906: 1–7. https://doi.org/10.1206/3906.1
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2016) PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34(3): 772–773. https://doi.org/10.1093/molbev/msw260
  • Lawson R, Slowinski JB, Crother BI, Burbrink FT (2005) Phylogeny of the Colubroidea (Serpentes): New evidence from mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution 37: 581–601. https://doi.org/10.1016/j.ympev.2005.07.016
  • Li JN, Liang D, Wang YY, Guo P, Huang S, Zhang P (2020) A large-scale systematic framework of Chinese snakes based on a unified multilocus marker system. Molecular Phylogenetics and Evolution 148: 106807. https://doi.org/10.1016/j.ympev.2020.106807
  • Li ZC, Xiao Z, Liu SH (2011) Amphibians and reptiles of Guangdong. Guangdong Science and Technology Press, Guangzhou, 266 pp. [in Chinese]
  • Malnate EV (1960) Systematic division and evolution of the colubrid snake genus Natrix, with comments on the subfamily Natricinae. Proceedings of the Academy of Natural Sciences of Philadelphia 112(3): 41–71.
  • Malnate EV (1962) The relationships of five species of the Asiatic natricine snake genus Amphiesma. Proceedings of the Academy of Natural Sciences of Philadelphia 114(8): 251–299.
  • Malkmus R, Manthey U, Vogel G, Hoffmann P, Kosuch J (2002) Amphibians & reptiles of Mount Kinabalu (north Borneo). Ruggell: A.R.G. Gantner Verlag, 424 pp.
  • Mell R (1931 [“1929”]) List of Chinese snakes. Lingnan Science Journal, Canton 8: 199–219.
  • Moichiro M (1931) A Monograph of the Snakes of Japan. Daiichi-Shobo, Tokyo, 240 pp. [in Japanese]
  • Narayanan J, Lakshmanan SG, Murugavel A (2020) Observations of three species of captive Keelbacks (Fowlea piscator, Atretium schistosum, and Amphiesma stolatum) (Natricidae). Reptiles & Amphibians 27(2): 271–274. https://doi.org/10.17161/randa.v27i2.14343
  • Nguyen VS, Ho TC, Nguyen QT (2009) Herpetofauna of Vietnam. Edition Chimaira, Frankfurt am Main, Germany, 768 pp.
  • Orlov NL, Murphy RW, Papenfuss TJ (2000) List of snakes of Tam-Dao Mountain ridge (Tonkin, Vietnam). Russian Journal of Herpetology 7(1): 69–80.
  • Peng ZL, Wu W, Tang CY, Ren JL, Jiang D, Li JT (2022) Transcriptome analysis reveals olfactory system expression characteristics of aquatic snakes. Frontiers in Genetics 13: 825974. https://doi.org/10.3389/fgene.2022.825974
  • Peters WCH (1871) Über neue Reptilien aus Ostafrika und Sarawak (Borneo), vorzüglich aus der Sammlung des Hrn. Marquis J. Doria zu Genua. Monatsberichte der königlichen Akademie der Wissenschaften zu Berlin 1871(11): 566–581.
  • Pope CH (1935) The reptiles of China. Turtles, Crocodilians, Snakes, Lizards. Natural History of Central Asia (Vol. X). The American Museum of Natural History, New York, 604 pp.
  • Ren JL, Wang K, Nguyen TT, Van Hoang C, Zhong GH, Jiang K, Guo P, Li JT (2018) Taxonomic re-evaluation of the monotypic genus Pararhabdophis Bourret, 1934 (Squamata: Colubridae: Natricinae) with discovery of its type species, P. chapaensis, from China. Zootaxa 4486(1): 31–56. https://doi.org/10.11646/zootaxa.4486.1.2
  • Ren JL (2019) Systematics and biogeography of Opisthotropis (Serpentes: Colubridae). Master Thesis, Chengdu Institute of Biology, Chinese Academy of Science, Chengdu, China, 222 pp. [in Chinese]
  • Ren JL, Jiang K, Huang JJ, David P, Li JT (2022) Taxonomic review of the genus Herpetoreas (Serpentes: Natricidae), with the description of a new species from Tibet, China. Diversity 14(2): 79. https://doi.org/10.3390/d14020079
  • Shen YH, Ye YY, Deng XJ (2014) Fauna Hunan reptilia. Hunan Science and Technology Press, Changsha, 220 pp. [in Chinese]
  • Smith MA (1943) The fauna of British India, Ceylon and Burma, including the whole of the Indo-Chinese sub-region. Reptilia and Amphibia. 3 (Serpentes). Taylor and Francis, London, 583 pp.
  • Van Denburgh J (1909) New and previously unrecorded species of reptiles and amphibians from the island of Formosa. Proceedings of the California Academy of Sciences 4(3): 49–56.
  • Wallach V, Williams KL, Boundy J (2014) Snakes of the world: a catalogue of living and extinct species. CRC Press Boca Raton, Florida, USA, 1237 pp.
  • Wang D, Ren JL, Jiang K, Wu W, Peng CJ, Zaher H, Jiang DC, Li JT (2022) Morphology and histochemistry of infralabial glands of two species in the slug-eating family Pareidae (Reptilia: Serpentes). Asian Herpetological Research 13(1): 180–189. http://doi.org/10.16373/j.cnki.ahr.210071
  • Wang K, Ren JL, Chen HM, Lyu ZT, Guo XG, Jiang K, Chen JM, Li JT, Guo P, Wang YY, Che J (2020) The updated checklists of amphibians and reptiles of China. Biodiversity Science 28: 189–218. [in Chinese] https://doi.org/10.17520/biods.2019238
  • Wu L, Li DJ, Liu JC (1985) Reptiles of Guizhou. Guizhou People’s Publishing House, Guiyang, 436 pp. [in Chinese]
  • Xiang GS, Li PX, Yang YR (2009) Colored illustrations of amphibians and reptiles of Taiwan. Owl Press, Taipei, 336 pp. [in Chinese]
  • Xie RG, Liu ZH, Qiu SM, Zheng WR, Nie JX, Ma WH (1998) Surveys of snakes in Deqing County, Guangdong Province, China. Russian Journal of Herpetology 5(1): 82.
  • Yang DT, Rao DQ (2008) Amphibia and reptilia of Yunnan. Yunnan Science and Technology Press, Kuming, 411 pp. [in Chinese]
  • Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096
  • Zhao EM, Adler K (1993) Herpetology of China. Society for the Study of Amphibians and Reptiles, Contributions to Herpetology 10: 522.
  • Zhang FJ, Hu SQ, Zhao EM (1984) Comparative studies and phylogenetic discussions on hemipenial morphology of the Chinese Colubrinae (Colubridae). Acta Herpetologica Sinica 3(3): 23–44. [in Chinese]
  • Zhang YX (2009) Herpetology in Guangxi. Guangxi Normal University Press, Guilin, 170 pp. [in Chinese]
  • Zhao EM, Huang MH, Zong Y (1998) Fauna Sinica, Reptilia, Squamata. Serpentes (Vol. 3). Science Press, Beijing, 522 pp. [in Chinese]
  • Zhao EM (2003) Colored atlas of reptiles of Sichuan. China Forestry Publishing House, Beijing, 292 pp. [in Chinese]
  • Zhao EM (2006) Snakes of China. Anhui Science and Technology Publishing House, Hefei, 669 pp. [in Chinese]
  • Zhou ZY, Sun ZY, Qi S, Lu YY, Lyu ZT, Wang YY, Li PP, Ma JZ (2019) A new species of the genus Hebius (Squamata: Colubridae: Natricinae) from Hunan Province, China. Zootaxa 4674(1): 68–82. https://doi.org/10.11646/zootaxa.4674.1.3
login to comment