We report the first record of Hoplobatrachus litoralis Hasan, Kuramoto, Islam, Alam, Khan & Sumida, 2012 from China based on seven specimens from Baoshan City, western Yunnan. Morphologically, the specimens from China mostly agree with the original description of H. litoralis and phylogenetically show a small genetic distance (1.7%) in the 16S rRNA gene with the specimens (including one paratype) of H. litoralis from its type locality in Bangladesh. Our work increased the species number of the genus Hoplobatrachus Peters, 1863 in China to two. This record is the easternmost distribution of this species at present. Furthermore, we found that the species H. salween Thongproh, Chunskul, Sringurngam, Waiprom, Makchai, Cota, Duengkae, Duangjai, Hasan, Chuaynkern & Chuaynkern, 2022 recently described from north-western Thailand is morphologically and genetically very similar to H. litoralis and, therefore, we discuss the validity of H. salween as a separate species.

16S rRNA, Baoshan, distribution, Longling, western Yunnan

For a long time, it was considered that only one species of the genus Hoplobatrachus Peters, 1863 was distributed in China, namely, H. chinensis (Osbeck, 1765) and it was thought to be widely distributed in southern China (Fei et al. 2009, 2012; AmphibiaChina 2022; Frost 2022). Although this species has a wide distribution range, it is regarded as a legally protected species in China due to the rapid decline of its population size (Jiang and Xie 2021).

Hoplobatrachus litoralis Hasan, Kuramoto, Islam, Alam, Khan & Sumida, 2012 is a species originally described from Bangladesh (Hasan et al. 2012). Subsequently, Mulcahy et al. (2018) and Zug (2022) extended the range of this species into Myanmar, while Purkayastha and Besak (2018), Mondal et al. (2018), Bohra et al. (2019), Kundu et al. (2020) and Lalremsanga et al. (2022) recorded this species in India and Wangyal et al. (2020) reported this species from Bhutan. Hoplobatrachus litoralis inhabits vegetated, marshy ditches or ponds. It is characterised by large body size, a broad black band from anterior corner of eye through the nostrils to anterior edge of upper jaw, a band along the lateral margin of upper jaw, a distinct black margin in the inner side of the upper arm, a black inner metatarsal tubercle and inter-orbital distance that is much narrower than eyelid width and inter-nostril distance (Hasan et al. 2012).

While studying the Hoplobatrachus specimen collection of Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ), we discovered a jar with seven specimens determined as H. chinensis and collected from Longling, Baoshan, Yunnan. After detailed examination of these specimens, we found that they more closely resemble H. litoralis rather than H. chinensis. Since molecular analysis conducted in this study also indicated that these specimens belong to H. litoralis, we report this new record for China in detail.

Genomic DNA was extracted from liver tissues using the standard phenol-chloroform extraction protocol (Sambrook et al. 1989). A partial fragment of the mitochondrial 16S rRNA was amplified for all samples via the polymerase chain reaction (PCR) using the primers L2188 (Matsui et al. 2006): 5’–AAAGTGGGCCTAAAAGCAGCCA–3’ and 16H1 (Hedges 1994): 5’–CTCCGGTCTGAACTCAGATCACGTAGG–3’. The products were purified and sequenced by Tsingke Biotechnology (Beijing) Co., Ltd. All new sequences were deposited in GenBank. Euphlyctis cyanophlyctis (Schneider, 1799) and E. hexadactyla (Lesson, 1834) were chosen as outgroups according to Hasan et al. (2012). Homologous and outgroup sequences were obtained from GenBank (Table 1). The technical computation methods for the best substitution model selection, Bayesian Inference and Maximum Likelihood phylogenetic analyses were the same as those in Liu et al. (2020).

Measurements were taken with a digital caliper to the nearest 0.1 mm. Morphological terminology follows Hasan et al. (2012). Abbreviations of the morphometric traits are as follows: snout-vent length (SVL), head length (HL), head width (HW), snout to nostril distance (S-N), inter-nostril distance (N-N), nostril to eye distance (N-E), horizontal eye diameter (ED), inter-orbital distance between inner borders of upper eyelids (E-E), eyelid width (ELW), horizontal tympanum diameter (TD), forelimb length (FLL), forearm and hand length (FHL), forearm width (FAW), hand length (HAL), length of 1^st to 4^th finger (F1-F4), hind-limb length (HLL), femur length (FEL), tibia length (TIL), tarsus and foot length (TFL), foot length (FOL), length of 1^st to 5^th toe (T1-T5) and inner metatarsal tubercle length (IMT).

Bayesian Inference and Maximum Likelihood analyses showed consistent topology. The sequences of the specimens from Baoshan, western Yunnan, China, clustered with the sequences of the specimens from Mae Hong Son, Thailand and Bago and Yangon, Myanmar and all together clustered with the sequences of the specimens of Hoplobatrachus litoralis from Bangladesh (including one paratype IABHU 3974) and India (Fig. 1). The average genetic distance (uncorrected p-distance) between the specimens from China and the specimens of H. litoralis from its type locality in Bangladesh (including one paratype IABHU 3974) is 1.7% and the average genetic distance (uncorrected p-distance) between the specimens from China and the specimen of H. litoralis from India is 1.4% (Table 2). Morphological measurements of the specimens from China are presented in Table 3. As the specimens from China are not adults, we only compared the body ratios of these specimens (Table 4) with the relevant data from the original description of H. litoralis by Hasan et al. (2012). The specimens from China have relatively greater snout to nostril distances (S-N/SVL 0.080–0.094 vs. 0.044–0.076), relatively greater eye diameters (ED/SVL 0.118–0.133 vs. 0.063–0.107) and relatively greater lengths of fourth toe (T4/SVL 0.397–0.438 vs. 0.277–0.368); apart from these, all other ratios of the specimens from China overlap with the relevant data from the original description of H. litoralis. In addition, the colour patterns on these specimens from China agree well with the original description of H. litoralis.

Figure 1. 

Maximum Likelihood tree based on 16S rRNA sequences. Numbers above branches indicate Bayesian posterior probabilities (values below 0.9 are not shown) and numbers below branches indicate bootstrap support for Maximum Likelihood analysis (values below 70 are not shown).

Taxonomic account

 Hoplobatrachus litoralis Hasan, Kuramoto, Islam, Alam, Khan & Sumida, 2012

Figs 2, 3, 4A, B

Specimens examined

KIZ 034006–KIZ 034012, seven subadults, all collected on 21 August 2013 from Manguanhe Village, Mengnuo Town, Longling County, Baoshan City, Yunnan Province, China (24°20'41"N, 99°1'11"E; elevation 750 m).

Morphological description

Head longer than wide (HL/HW 1.13–1.23), obtusely pointed. Canthus rostralis blunt. Loreal region concave. Nostril slightly nearer to tip of snout than to eye (S-N/N-E 0.78–0.97). Tympanum smaller than eye (TD/ED 0.51–0.59). Inter-orbital space much narrower than eyelid width and inter-nostril space (E-E/ELW 0.48–0.70, E-E/N-N 0.50–0.78).

Fingertips blunt without disc, no webbing on fingers. Finger length F3 > F1 > F2 > F4 or F3 > F1 > F4 > F2. Subarticular, thenar and palmar tubercles distinct.

Hind-limb moderately long (HLL/SVL 1.53–1.71). Femur length almost equal to tibia length (FEL/TIL 0.92–1.01). Toe tips blunt, slightly rounded. Toe length T4 > T5 > T3 > T2 > T1 or T4 > T3 > T5 > T2 > T1. Webbing reaching the base of toe tip, incurved between toe tips. Subarticular tubercles moderate, inner metatarsal tubercle distinct, no outer metatarsal tubercle.

Many distinct thin longitudinal ridges on dorsum. Indistinct small round warts over dorsal and lateral body. Dorsal limbs smooth. Supratympanic fold from behind eye to posterior margin of tympanum. Weak tarsal ridge extending from proximal end of inner metatarsal tubercle to heel.

Figure 2. 

The specimens of Hoplobatrachus litoralis from China in preservative. A. Dorsal view; B. Ventral view.

Colouration

In preservative, dorsum light grey to dark grey, a whitish mid-dorsal stripe from tip of snout to vent. Many large black spots on dorsal and lateral body. Large oval black spots on dorsal surface of limbs. A distinct black stripe from tip of snout through nostril to anterior corner of eye on each side. A short black stripe below eye each side. A gradually widening black stripe along supratympanic fold on each side. Upper lips brown, lower lips white with some black spots. A light thick stripe from posterior corner of eye to groin on each side. Rear side of thigh heavily mottled. Ventral side white, except for some black spots along the edge of lower jaw to the base of forelimb.

Figure 3. 

Close-up views of the specimen (KIZ 034010) of Hoplobatrachus litoralis from China in preservative. A. Lateral view of the head; B. Front view of the head; C. Volar view of left hand; D. Plantar view of left foot.

Recommended Chinese name

孟加拉虎纹蛙 (Pinyin: mèng jiā lā hǔ wén wā).

Comparison between Hoplobatrachus litoralis and H. chinensis

Hoplobatrachus litoralis differs from H. chinensis by snout to anterior eye stripe present in H. litoralis vs. absent in H. chinensis, supralabial stripe present in H. litoralis vs. absent in H. chinensis, mid-dorsal stripe present in H. litoralis vs. absent in H. chinensis, distinct large round black spots on dorsum of H. litoralis vs. indistinct irregular small black spots on dorsum of H. chinensis, light stripe from posterior corner of eye to groin present in H. litoralis vs. absent or indistinct in H. chinensis, ventral side of head with no spot except for some spots along the edge of lower jaw in H. litoralis vs. ventral side of head scattered with black spots in some individuals of H. chinensis and dorsal skin relatively smoother in H. litoralis vs. dorsal skin relatively rougher in H. chinensis (see Fig. 4).

Figure 4. 

Comparison of Hoplobatrachus litoralis and H. chinensis. A, B. H. litoralis in life from western Yunnan, China; C, D. H. chinensis in life from southern Yunnan, China.

This study is the first record of Hoplobatrachus litoralis from China. The new locality in China is approximately 770 km away from the type locality of this species and is also the easternmost part of its distribution range to date (Fig. 5). Our work brings the species number of the genus Hoplobatrachus in China to two. Species of the genus Hoplobatrachus have been regarded as legally protected in China. Finding out how many species of this genus live in China contributes to the better protection of these endangered amphibians.

Figure 5. 

Map showing the currently known distribution of Hoplobatrachus litoralis. The black star indicates the type locality, black dots indicate previously published records and the red dot indicates the new record in China.

The specific name of this species is derived from the Latin litoralis meaning coastal, as this species was originally considered to be distributed only in the coastal belt of Bangladesh (Hasan et al. 2012). However, Hoplobatrachus litoralis was subsequently found frequently in inland areas far from the coastal belt (Mulcahy et al. 2018; Purkayastha and Besak 2018; Bohra et al. 2019; Kundu et al. 2020; Wangyal et al. 2020; Lalremsanga et al. 2022). This shows that this species is also widespread beyond coastal areas. Therefore, we did not directly translate the specific name plus the generic name as the Chinese name, but chose the translation of Bangladesh plus the generic name as the Chinese name of this species.

Recently, Thongproh et al. (2022) described the specimens from north-western Thailand as a new species of Hoplobatrachus, namely Hoplobatrachus salween Thongproh, Chunskul, Sringurngam, Waiprom, Makchai, Cota, Duengkae, Duangjai, Hasan, Chuaynkern & Chuaynkern, 2022 and they considered the previous record of H. litoralis from northern Tanintharyi, Myanmar, also to belong to H. salween (Thongproh et al. 2022). However, through our phylogenetic analysis based on 16S rRNA, the specimens from China, the specimens of H. salween from Thailand and Myanmar and the specimens of H. litoralis from Bangladesh and India formed a monophyletic clade (Fig. 1). Although the average genetic distance between the specimens of H. salween and the specimens of H. litoralis from Bangladesh reached 2.2%–2.5% in this study, the genetic distance between the specimens of H. salween and the specimen of H. litoralis from India is only 1.4%–1.8% (Table 2). In addition, the average genetic distance between the specimens of H. salween and the specimens from China is only 1.3%–1.6% (Table 2). Therefore, the molecular data do not support H. salween and H. litoralis being two separate species. Morphologically, according to Thongproh et al. (2022), the snout to anterior eye stripe is indistinct in H. salween, whereas distinct in H. litoralis, the supralabial stripe is indistinct in H. salween, whereas distinct in H. litoralis, the dark supratympanic stripe is present in H. salween, whereas absent in H. litoralis, the hand pattern is mottled in H. salween, whereas uniform in H. litoralis, the web pattern is mottled with an irregular pattern in H. salween, whereas uniform grey in H. litoralis, the tubercles on the dorsal tibia of males are densely in H. salween, whereas few in H. litoralis, sexual dichromatism is present in H. salween, whereas absent in H. litoralis during the breeding season, the relative finger length is F3 > F1 > F4 > F2 in H. salween, whereas F3 > F1 > F2 > F4 in H. litoralis and the relative toe length is T4 > T3 > T5 > T2 > T1 in H. salween, whereas T4 > T5 > T3 > T2 > T1 in H. litoralis. However, the snout to anterior eye stripe is distinct in some individuals of H. salween (see fig. 6A in Thongproh et al. (2022)), the supralabial stripe is distinct in some individuals of H. salween (see fig. 6B in Thongproh et al. (2022)), the dark supratympanic stripe is present in some individuals of H. litoralis (see fig. 1A in Hasan et al. (2012) and fig. 2 in Lalremsanga et al. (2022)) and, in the specimens from China, the hand pattern is not uniform in the specimens from China, the relative finger length is either F3 > F1 > F2 > F4 or F3 > F1 > F4 > F2 in the specimens from China and the relative toe length is either T4 > T5 > T3 > T2 > T1 or T4 > T3 > T5 > T2 > T1 in the specimens from China. In addition, we found that the adult males from western Yunnan in life also present almost completely yellow colouration during the breeding season. We are not sure whether the remaining two differences in the web colouration and the tubercles on the dorsal tibia are stable and these differences seem to be insufficient to distinguish different species, they may be treated as intraspecific variation. To sum up, H. litoralis and H. salween cannot be completely separated in both morphological and molecular markers and the specimens from China seem to represent the transitional type between H. litoralis and H. salween. Therefore, we consider that H. salween should be a junior synonym of H. litoralis.

We would like to thank the curator of Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences, for his support of this study. We thank Hong Hui for providing photos. Thanks also to the editor and reviewers for their valuable comments on the manuscript. This work was supported by Science-Technology Basic Condition Platform from the Ministry of Science and Technology of the People’s Republic of China (Grant No. 2005DKA21402).