Research Article
Print
Research Article
Phylogenetic position of Odorrana macrotympana (Yang, 2008) (Anura, Ranidae) and extension of its geographical distribution
expand article infoShuo Liu‡, Dingqi Rao§, Dongru Zhang§, Ye Htet Lwin|, Mingzhong Mo, Changsheng Zuo#, Fawang Yin#, Ruichang Quan|¤, Song Li‡
‡ Kunming Natural History Museum of Zoology, Kunming, China
§ Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China
| Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences, Nay Pyi Taw, Myanmar
¶ Honghe Prefecture Forestry and Grassland Bureau of Yunnan Province, Mengzi, China
# Tongbiguan Provincial Natural Reserve Management and Protection Bureau, Yingjiang, China
¤ Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Mengla, China

Corresponding author: Ruichang Quan ( quanrc@xtbg.ac.cn )

Corresponding author: Song Li ( lis@mail.kiz.ac.cn )

Academic editor: Günter Gollmann
© 2022 Shuo Liu, Dingqi Rao, Dongru Zhang, Ye Htet Lwin, Mingzhong Mo, Changsheng Zuo, Fawang Yin, Ruichang Quan, Song Li.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Liu S, Rao D, Zhang D, Lwin YH, Mo M, Zuo C, Yin F, Quan R, Li S (2022) Phylogenetic position of Odorrana macrotympana (Yang, 2008) (Anura, Ranidae) and extension of its geographical distribution. Herpetozoa 35: 9-19. https://doi.org/10.3897/herpetozoa.35.e77147
ZooBank: urn:lsid:zoobank.org:pub:14210910-7D4B-4B80-85D0-76B70E939916
Open Access

Abstract

Based on a 16S rRNA gene fragment, a molecular phylogeny for the genus Odorrana Fei, Ye & Huang, 1990 was reconstructed, the validity of the poorly-known ranid species O. macrotympana (Yang, 2008) was confirmed and its phylogenetic position was evaluated. In addition, we report the first country record of O. macrotympana from Myanmar, based on our new records from Htamanthi Wildlife Sanctuary, Sagaing Division and present a supplementary description of this species. This report also constitutes the first record of O. macrotympana from outside of China.

Key Words

16S rRNA, China, Htamanthi Wildlife Sanctuary, morphology, Myanmar, new record, western Yunnan

Introduction

Odorrana macrotympana is a poorly-known ranid species described, based on only two specimens from Xueli Village, Taiping Town, Yingjiang County, Dehong Prefecture, Yunnan Province, China, close to the border with Myanmar (Yang and Rao 2008). This species was originally placed in the genus Rana Linnaeus, 1758 and was transferred into the genus Odorrana by Frost (2009).

Odorrana macrotympana most closely resembles O. tiannanensis (Yang & Li, 1980), but it is characterised by the following characters: lips uniform white without any spots or streaks, dorsal skin smooth and intermittent dorsolateral folds present, tympanum large and external vocal sac present in males (Yang and Rao 2008). Odorrana macrotympana was previously known only from the type locality and there have been few records of this species since its original description (Fei et al. 2009, 2012; AmphibiaChina 2021; Frost 2021).

As no molecular data were available for Odorrana macrotympana so far, the phylogenetic position of O. macrotympana has never been inferred and, thus, its systematic affinities remain unresolved. During our field surveys in Yunnan Province, China and in northern Myanmar from 2009 to 2021, we collected one topotype of O. macrotympana from its type locality, Yingjiang County, Dehong Prefecture, Yunnan Province, China; five specimens of Odorrana cf. macrotympana from Htamanthi Wildlife Sanctuary, northern Myanmar; and four topotypes of O. tiannanensis from its type locality, Hekou County, Honghe Prefecture, Yunnan Province, China, respectively. We collected DNA sequence data of these specimens in order to reconstruct a molecular phylogeny and evaluate the phylogenetic position of O. macrotympana.

In addition, our phylogenetic analysis of molecular data demonstrated that the specimens from northern Myanmar should be assigned to Odorrana macrotympana. Thus, this report constitutes the first record for the species outside China and from the country of Myanmar.

Materials and methods

Taxon sampling

Field survey in Yingjiang County, Yunnan Province, China, was conducted under permits from Tongbiguan Provincial Natural Reserve Management and Protection Bureau; field survey in Hekou County, Yunnan Province, China, was conducted under permits from Honghe Prefecture Forestry and Grassland Bureau of Yunnan Province; and the field survey in northern Myanmar was undertaken at the invitation of the Republic of the Union of Myanmar, Ministry of Natural Resources and Environmental Conservation, Forest Department, Forest Research Institute. After live photographs were taken, specimens were collected, euthanised with ethyl acetate and fixed in 75% ethanol for storage. Liver tissue samples were preserved in 99% ethanol for molecular analysis. The specimens from China were deposited in Kunming Institute of Zoology, Chinese Academy of Sciences (abbreviation: KIZ; address: Kunming, Yunnan, China) and specimens from Myanmar were deposited in Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences (abbreviation: SEABRI; address: Yezin, Nay Pyi Taw, Myanmar).

Morphology

Measurements were taken with a digital caliper to the nearest 0.1 mm by Shuo Liu. We measured: snout-vent length (SVL, from tip of snout to vent); head length (HL, from tip of snout to rear of jaw); head width (HW, width of head at widest point); snout length (SL, from tip of snout to anterior border of eye); eye diameter (ED, diameter of exposed portion of eyeball); tympanum diameter (TD, maximum diameter of tympanum); forearm and hand length (FHL, from elbow to tip of third finger); hand length (HAL, from the base of the outer palmar tubercle to the tip of third finger); total leg length (LEG, from vent to tip of fourth toe); tibia length (TL, distance from knee to heel); and tarsus and foot length (TFL, from heel to the tip of fourth toe). Morphological data of the type specimens of Odorrana macrotympana were taken from Yang and Rao (2008).

Collection and analysis of molecular data

Total genomic DNA was extracted from liver tissues using the DNeasy Tissue Kit (Qiagen, Inc., Valencia, CA). A fragment encoding mitochondrial 16S rRNA gene was amplified and sequenced. All new sequences have been deposited in GenBank, other sequences being downloaded from GenBank (Table 1). Sequences of Rana chensinensis David, 1875 and Pelophylax nigromaculatus (Hallowell, 1861) were used as outgroups (Chen et al. 2013; Feng et al. 2017; Yuan et al. 2019; Liu et al. 2021; Zhang et al. 2021). The primers L2188 (Matsui et al. 2006): 5’–AAAGTGGGCCTAAAAGCAGCCA–3’ and 16H1 (Hedges 1994): 5’–CTCCGGTCTGAACTCAGATCACGTAGG–3’ were used in amplification and cycle sequencing. Amplified DNA was produced in 25 μl reactions after 30 cycles of denaturation for 60 sec at 94 °C, annealing for 60 sec at 43–46 °C and extension for 1 min at 72 °C. PCR products were isolated through 1% agarose gel electrophoresis and further purified using Millipore Microcon Kits. Purified PCR products were sequenced by Davis Sequencing and sequences were edited and manually managed using SeqMan in Lasergene 7.1 (DNASTAR Inc., Madison, WI, USA) and MEGA X (Kumar et al. 2018).

Table 1.
Download as
CSV
XLSX

Samples used for phylogenetic analyses of molecular sequence data. * = type locality.

Species Locality Voucher No. GenBank No.
Odorrana absita Xe Sap, Xe Kong, Laos* FMNH258109 EU861542
Odorrana amamiensis Tokunoshima, Ryukyu, Japan KUHE24635 AB200947
Odorrana anlungensis Anlong, Guizhou, China* HNNU1008I109 KF185049
Odorrana aureola Phu Luang, Loei, Thailand* ZMKU AM 01137 KT002162
Odorrana bacboensis Khe Moi, Nghe An, Vietnam* FMNH255611 DQ650569
Odorrana banaorum Tram Lap, Gia Lai, Vietnam ROM7472 AF206487
Odorrana chapaensis Lai Chau, Vietnam AMNH A161439 DQ283372
Odorrana chloronota Darjeeling, West Bengal, India* BMNH 1947.2.28.6 DQ650594
Odorrana daorum Sa Pa, Lao Cai, Vietnam ROM19053 AF206482
Odorrana dulongensis Dulongjiang, Yunnan, China* KIZ035027 MW128102
Odorrana exiliversabilis Wuyishan, Fujian, China* HNNU0607032 KF185056
Odorrana fengkaiensis Shiwanshan, Guangxi, China HNNU295 7k KF185033
Odorrana geminata Cao Bo, Ha Giang, Vietnam AMNH 163782 EU861546
Odorrana grahami Kunming, Yunnan, China* HNNU1008II016 KF185051
Odorrana graminea Wuzhishan, Hainan, China* HNNU0606123 KF185038
Odorrana hainanensis Wuzhishan, Hainan, China* HNNU0606105 KF185032
Odorrana hejiangensis Hejiang, Sichuan, China* HNNU1007I202 KF185052
Odorrana hosii Kuala Lumpur, Malaysia IABHU 21004 AB511284
Odorrana huanggangensis Wuyishan, Fujian, China* HNNU0607001 KF185059
Odorrana ishikawae Amami Island, Ryukyu, Japan No voucher AB511282
Odorrana jingdongensis Jingdong, Yunan, China* 20070711017 KF185050
Odorrana junlianensis Junlian, Sichuan, China* HNNU002 KF185058
Odorrana kuangwuensis Nanjiang, Sichuan, China* HNNU0908II185 KF185034
Odorrana kweichowensis Shilian, Meitan, Guizhou, China CIBGYU20130917004 MH193548
Odorrana leporipes Shaoguan, Guangdong, China* HNNU1008I099 KF185036
Odorrana lipuensis Lipu, Guilin, Guangxi, China* NHMG1306002 KM388699
Odorrana livida Thagata Juwa, Myanmar* BMNH 1889.2.25.48 DQ650615
Odorrana lungshengensis Longsheng, Guangxi, China* HNNU70028 KF185054
Odorrana macrotympana Yingjiang, Yunnan, China* KIZ 2009051020 OL831010
Odorrana macrotympana Htamanthi, Sagaing, Myanmar SEABRI 2019120040 OL831011
Odorrana macrotympana Htamanthi, Sagaing, Myanmar SEABRI 2019120041 OL831012
Odorrana macrotympana Htamanthi, Sagaing, Myanmar SEABRI 2019120072 OL831013
Odorrana macrotympana Htamanthi, Sagaing, Myanmar SEABRI 2019120073 OL831014
Odorrana margaretae Emei, Sichuan, China HNNU20050032 KF185035
Odorrana morafkai Tram Lap, Gia Lai, Vietnam ROM7446 AF206484
Odorrana nanjiangensis Nanjiang, Sichuan, China* HNNU1007I291 KF185042
Odorrana narina Okinawa Island, Ryukyu, Japan No voucher AB511287
Odorrana nasica Ha Tinh, Vietnam AMNH A161169 DQ283345
Odorrana nasuta Wuzhishan, Hainan, China* HNNU051119 KF185053
Odorrana sangzhiensis Sangzhi, Hunan, China* CSUFT 4305220051 MW464865
Odorrana schmackeri Yichang, Hubei, China* HNNU0908II349 KF185047
Odorrana supranarina Iriomotejima, Ryukyu, Japan KUHE2898 AB200950
Odorrana swinhoana Nantou, Taiwan, China HNNUTW9 KF185046
Odorrana tianmuii Tianmushan, Zhejiang, China* NHMG1303018 KT315390
Odorrana tiannanensis Hekou, Yunnan, China* KIZ20193272 OL831009
Odorrana tiannanensis Hekou, Yunnan, China* KIZ20193273 OL831008
Odorrana tiannanensis Hekou, Yunnan, China* KIZ20193274 OL831007
Odorrana tiannanensis Hekou, Yunnan, China* KIZ20215191 OL831006
Odorrana tiannanensis Hekou, Yunnan, China* SCUM50510CHX EF453751
Odorrana tormota Huangshan, Anhui, China* No voucher DQ835616
Odorrana trankieni Ta Xua, Son La, Vietnam* VNMN04035 KX893900
Odorrana utsunomiyaorum Iriomotejima, Ryukyu, Japan KUHE12896 AB200952
Odorrana versabilis Leishan, Guizhou, China* HNNU003 LS KF185055
Odorrana wuchuanensis Wuchuan, Guizhou, China* HNNU019 L KF185043
Odorrana yentuensis Tay Yen Tu, Bac Giang, Vietnam* IEBRA.2015.38 KX893891
Odorrana yizhangensis Yizhang, Hunan, China* HNNU1008I075 KF185048
Odorrana yunnanensis Longchuan, Yunnan, China* HNNU001YN KF185057
Pelophylax nigromaculatus Aichi, Japan No voucher LC389208
Rana chensinensis Ningshan, Shanxi, China HNNU20060359 KF185061

Sequences were aligned using MAFFT 7 (Katoh and Standley 2013) with default parameters. The best substitution models were selected using the Bayesian Information Criterion (BIC) in ModelFinder (Kalyaanamoorthy et al. 2017) as implemented in IQ-TREE 1.6.12 (Nguyen et al. 2015). Bayesian Inference (BI) was performed in MrBayes 3.2.7 (Ronquist et al. 2012), based on the GTR+F+I+G4 substitution model and the Markov chains were run for 10,000,000 generations and sampled every 1,000 generations. Maximum Likelihood (ML) analysis was performed in IQ-TREE 1.6.12 (Nguyen et al. 2015), based on the TIM2+F+R4 substitution model and 1,000 bootstrap pseudoreplicates via the ultrafast bootstrap approximation algorithm were used to construct a final consensus tree. The genetic divergences (uncorrected p-distance) were calculated in MEGA X (Kumar et al. 2018).

Results

Phylogenetic analyses

The sequence alignment is 1095 bp in length. Topologies resulting from BI and ML analyses were consistent. The sequences of the specimens from Myanmar clustered with the sequence of our single topotype of Odorrana macrotympana; together, they represent a distinct lineage in the genus Odorrana, which is sister to O. tiannanensis with strong support (Fig. 1).

Figure 1. 

Phylogenetic tree of Odorrana, inferred from BI analysis of a 1095 bp fragment of the 16S rRNA. Numbers before slashes indicate Bayesian posterior probabilities (≥ 0.90) and numbers after slashes indicate bootstrap support from a separate ML analysis (≥ 90).

Genetic distances

Genetic divergence (uncorrected p-distance) between the specimens from Myanmar and the topotype of Odorrana macrotympana was only 0.43% (Suppl. material 1: Table S1). Therefore, we considered the Myanmar population to be conspecific with O. macrotympana. Genetic divergence (uncorrected p-distance) between O. macrotympana and other species of Odorrana ranged from 9.51% to 16.87% (Suppl. material 1: Table S1), suggesting that O. macrotympana is a valid species.

Taxonomic accounts

Odorrana macrotympana (Yang, 2008)

Suggested common English name “Large Eared Odorous Frog” Figs 2, 3, 4, 5, 6 and 8B

Holotype

KIZ 94001, adult female.

Paratype

KIZ 94002, adult male.

Type locality

Xueli Village, Taiping Town, Yingjiang County, Dehong Prefecture, Yunnan Province, China.

Other materials

KIZ 2009051020, One adult female, collected by Dingqi Rao from Xueli Village, Taiping Town, Yingjiang County, Dehong Prefecture, Yunnan Province, China (24°26'29"N, 97°33'42"E, 330 m elevation), on 10 May 2009. SEABRI 2019120040, one adult male and SEABRI 2019120041, one adult female, collected by Shuo Liu from Nam Pa Gon section, Htamanthi Wildlife Sanctuary, Sagaing Division, Myanmar (25°19'3"N, 95°31'43"E, 140 m elevation), on 2 December 2019. SEABRI 2019120072 and SEABRI 2019120074, two adult males and SEABRI 2019120073, one adult female, collected by Shuo Liu from Nam E Zu section, Htamanthi Wildlife Sanctuary, Sagaing Division, Myanmar (25°28'8"N, 95°38'57"E, 130 m elevation), on 9 December 2019.

Figure 2. 

Type specimens of Odorrana macrotympana in preservative: A. Dorsal and B. Ventral, view of the holotype (KIZ 94001, female); C. Dorsal and D. Ventral, view of the paratype (KIZ 94002, male); E. Lateral view of the head of the holotype (KIZ 94001, female); F. Lateral view of the head of the paratype (KIZ 94002, male). Photo by Shuo Liu.

Description of the specimens from Myanmar

Measurements and the comparison with the type specimens are represented in Table 2. Habitus moderately slender, SVL 56.7–59.1 mm in males and 91.6–111.2 mm in females; head width slightly shorter than length (HW/HL 0.89–0.97); snout obtuse, pointed in dorsal view and rounded in profile, obviously projecting beyond lower jaw; position of nostril dorsolateral, closer to snout than eye; canthus rostralis distinct; loreal region concave and vertical; internarial distance greater than interorbital distance; snout length greater than eye diameter; pineal body distinct; supratympanic fold horizontal and straight; tympanum very large in males (TD/ED 0.71–0.78) and relatively small in females (TD/ED 0.56–0.62), round and transparent; vomerine teeth distinct; choanae close to the vomerine teeth. Tongue cordiform, posterior notch enlarged and formed as U-shaped; vocal sac openings visible on floor of mouth, in each corner; paired external vocal sacs present in males.

Table 2.
Download as
CSV
XLSX

Measurements (mm) of Odorrana macrotympana. See text for character definitions. Data of the type specimens were obtained from the original description (Yang and Rao 2008). Notes: HAL of holotype, originally reported as “26 mm” is parenthetically included, along with the true value (16 mm).

KIZ 94001 KIZ 94002 SEABRI 2019120040 SEABRI 2019120041 SEABRI 2019120072 SEABRI 2019120073 SEABRI 2019120074
Holotype Paratype
Female Male Male Female Male Female Male
SVL 95 50 56.8 111.2 59.1 91.6 56.7
HL 35.5 20 22.3 40.6 24.8 33.4 23.8
HW 32 17 21.2 37.2 22.0 32.5 22.2
SL 15 8 10.1 18.2 10.3 15.6 10.8
ED 13 7.5 7.9 11.7 8.2 9.2 8.0
TD 6 5.5 5.6 6.6 5.8 5.7 6.2
FHL 41.5 24 28.5 50.6 29.7 45.2 27.2
HAL 16 (26) 15.5 16.4 27.7 18.6 26.5 17.9
LEG 185 100 117.0 219.0 121.0 195.5 117.0
TL 63.5 32.5 36.2 68.7 38.5 60.2 35.9
TFL 75.5 42.5 46.2 84.5 49.7 76.5 46.3
Figure 3. 

Adult female topotype of Odorrana macrotympana from its type locality: A. Dorsal view; B. Ventral view. Photo by Xiaofeng Ma and Hong Hui.

Figure 4. 

Specimens of Odorrana macrotympana from Myanmar in preservative: A. Dorsal view; B. Ventral view. Photo by Shuo Liu.

Figure 5. 

Live colour variation in Odorrana macrotympana from Htamanthi Wildlife Sanctuary, Sagaing Division, Myanmar: A, B, C. Adult males; D. Subadult female; E, F. Adult females. Photo by Shuo Liu.

Figure 6. 

Live ventral colour variation in Odorrana macrotympana from Myanmar: A, B. Adult males; C. Subadult female; D. Adult female. Photo by Shuo Liu.

Forelimbs robust in males and relatively weak in females; relative lengths of fingers III > IV > I > II; all finger tips slightly expanded; lateral fringes and webbing on fingers absent; subarticular tubercle round and prominent; inner metacarpal tubercle and outer metacarpal tubercle distinct; greyish-yellow glandular nuptial pad on finger I in males.

Hind limbs long, tibia slightly longer than thigh; toes long and thin, relative lengths IV > V > III > II > I; all toe tips slightly expanded; entire webbing; subarticular tubercles prominent and longitudinally ovoid; inner metatarsal tubercle prominent and oval; outer metatarsal absent.

Dorsal skin smooth, lateral skin granular, ventral skin smooth. Dorsolateral folds distinct.

Colouration in life

Dorsum greyish-brown, brownish-green or solid green with a few or many tiny black spots and several distinct or indistinct large black or brown spots. Upper and lower lips greyish-white, yellow, light green or brown with a few or many brown or black spots. Lateral side of head and body greyish-brown with many large or tiny black spots. Dorsal surfaces of limbs greyish-brown with some brown or black bands. Ventral surface of throat, chest and belly uniform white or some stains on ventral surface of throat, chest and anterior part of belly. Ventral surface of limbs white or pink. Tympanum brown, iris greyish-brown, pupil black.

Figure 7. 

Type locality in western Yunnan, China (red star) and new collection sites in northern Myanmar (red dots) summarising all known localities for Odorrana macrotympana.

Figure 8. 

Habitat of Odorrana macrotympana in A. The Htamanthi Wildlife Sanctuary, Myanmar; B. Male and female in amplexus. Photo by Shuo Liu.

Colouration in preservative

In preservative, dorsum fades to greyish-black. Ventral surface of throat, chest, belly and limbs pale white. Iris black, pupil white.

Sexual dimorphism

Body size much smaller in adult males than in adult females, adult males have relatively stouter forelimbs than females and greyish-yellow glandular nuptial pad on finger I, external vocal sacs present in adult males.

Natural history notes

In Myanmar, all specimens of Odorrana macrotympana were found on the banks of large rivers. During December, we heard the courtship calls from males on the river banks at night, the sound of the calls being similar to those of other Odorrana species. We also observed males and females in amplexus on the banks of the rivers. No eggs or tadpoles were found.

Discussion

According to Yang and Rao (2008), Odorrana macrotympana is a distinct species and most closely resembles O. tiannanensis. Our molecular analyses revealed that O. macrotympana was a sister lineage of O. tiannanensis (Fig. 1) and the genetic divergence between O. macrotympana and O. tiannanensis was 9.51% (Suppl. material 1: Table S1). This study agrees with Yang and Rao (2008) that O. macrotympana is a valid species and closely related to O. tiannanensis, although they are distributed far apart (the distance between the type localities of O. macrotympana and O. tiannanensis is approximately 660 km).

Previously, Odorrana macrotympana was known only from its type locality (Yang and Rao 2008; Fei et al. 2009, 2012; AmphibiaChina 2021; Frost 2021), located by the Dayingjiang River, a tributary of the Ayeyarwady River. Here, we report collections of this species from Htamanthi Wildlife Sanctuary, northern Myanmar, located by the Chindwin River, also a tributary of the Ayeyarwady River. Our finding significantly extended the known distribution of this species, indicating that this species is widely distributed in the Ayeyarwady River system. The new Myanmar record is approximately 230 km from the type locality in China. Additionally, within the Htamanthi Wildlife Sanctuary, Myanmar, O. macrotympana was quite abundant (we observed a large population at ~ 140 m elevation). However, at the type locality in China (~ 300 m elevation), the species is not abundant and the original population is comparatively small. We speculate that western Yunnan forms the edge of its distribution and northern Myanmar may be closer to the centre of this species’ distribution.

Morphologically, the characters of the specimens from northern Myanmar mostly agree with the original description of Odorrana macrotympana apart from a few differences. According to the original description of O. macrotympana, the dorsum is greyish-brown and upper and lower lips are uniform white without any spots or streaks (Yang and Rao 2008). However, dorsal surfaces of specimens from northern Myanmar vary from greyish-brown to brownish-green or solid green and lips vary from greyish-white to yellow, light green or brown with variable dark spots. Thus, dorsal and labial colour characteristics, originally proposed as diagnostic characters for this species, may be more variable (and non-diagnostic) than originally reported (Yang and Rao 2008).

The type specimens of Odorrana macrotympana were collected in December 1994 and females have been observed to deposit eggs in February of the following year (Yang and Rao 2008). We heard male courtship calls and observed pairs in amplexus during December in northern Myanmar, which is basically consistent with original reports from China (Yang and Rao 2008). It is unknown whether this species also reproduces during months outside of this (December–February) range.

Acknowledgements

Our field survey in Myanmar was undertaken at the invitation of the Republic of the Union of Myanmar, Ministry of Natural Resources and Environmental Conservation, Forest Department, Forest Research Institute. We thank the Ministry of Myanmar for its invitation and its staff and the local guides for their help in the field. Thank Bin Yang for helping us collect specimens. Thanks to Xiaofeng Ma and Hong Hui for providing photos and Xinwang Yang for providing information about specimen collection. We also thank the editors and reviewers for their working on the manuscript.

References

  • Chen XH, Chen Z, Jiang JP, Qiao L, Lu YQ, Zhou KY, Zheng GM, Zhai XF, Liu JX (2013) Molecular phylogeny and diversification of the genus Odorrana (Amphibia, Anura, Ranidae) inferred from two mitochondrial genes. Molecular Phylogenetics and Evolution 69(3): 1196–1202. https://doi.org/10.1016/j.ympev.2013.07.023
  • Chen Z, Li HY, Zhai XF, Zhu YJ, He YX, Wang QY, Li Z, Jiang JP, Xiong RC, Chen XH (2020) Phylogeography, speciation and demographic history: Contrasting evidence from mitochondrial and nuclear markers of the Odorrana graminea sensu lato (Anura, Ranidae) in China. Molecular Phylogenetics and Evolution 144: 1–15. https://doi.org/10.1016/j.ympev.2019.106701
  • Fei L, Hu SQ, Ye CY, Huang YZ (2009) Fauna Sinica (Vol. 2). Amphibia Anura. Science Press, Beijing, 957 pp.
  • Fei L, Ye CY, Jiang JP (2012) Colored Atlas of Chinese Amphibians and Their Distributions. Sichuan Publishing House of Science and Technology, Chengdu, 620 pp.
  • Feng Y, Blackburn DC, Liang D, Hillis DM, Wake DB, Cannatella DC, Zhang P (2017) Phylogenomics reveals rapid, simultaneous diversification of three major clades of Gondwanan frogs at the Cretaceous-Paleogene boundary. Proceedings of the National Academy of Sciences of the United States of America 114: E5864–E5870. https://doi.org/10.1073/pnas.1704632114
  • Frost DR (2009) Amphibian Species of the World: An Online Reference. Version 5.3. (12 February 2009). Electronic Database.
  • Hedges SB (1994) Molecular evidence for the origin of birds. Proceedings of the National Academy of Sciences of the United States of America 91: 2621–2624. https://doi.org/10.1073/pnas.91.7.2621
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Liu XL, He YH, Wang YF, Beukema W, Hou SB, Li YC, Che J, Yuan ZY (2021) A new frog species of the genus Odorrana (Anura: Ranidae) from Yunnan, China. Zootaxa 4908: 263–275. https://doi.org/10.11646/zootaxa.4908.2.7
  • Matsui M, Shimada T, Liu WZ, Maryati M, Khonsue W, Orlov N (2006) Phylogenetic relationships of oriental torrent frogs in the genus Amolops and its allies (Amphibia, Anura, Ranidae). Molecular Phylogenetics and Evolution 38: 659–666. https://doi.org/10.1016/j.ympev.2005.11.019
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300
  • Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Yang DT, Rao DQ (2008) Amphibia and Reptilia of Yunnan. Yunnan Publishing Group Corporation, Yunnan Science and Technology Press, Kunming, 411 pp.
  • Yuan ZY, Zhang BL, Raxworthy CJ, Weisrock DW, Hime PM, Jin JQ, Lemmon EM, Lemmon AR, Holland SD, Kortyna M, Zhou WW, Peng MS, Che J, Prendini E (2019) Natatanuran frogs used the Indian Plate to stepstone disperse and radiate across the Indian Ocean. National Science Review 6: 10–14. https://doi.org/10.1093/nsr/nwy092

Supplementary material

Supplementary material 1 

Table S1

Shuo Liu, Dingqi Rao, Dongru Zhang, Ye Htet Lwin, Mingzhong Mo, Changsheng Zuo, Fawang Yin, Ruichang Quan, Song Li

Data type: Table (MS EXCEL file)

Explanation note: Genetic divergence (uncorrected p-distance) (%) based on the mitochondrial 16S rRNA gene sequences.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (39.50 kb)
login to comment