Research Article |
|
Corresponding author: Eskandar Rastegar-Pouyani ( rastegarpouyani45@gmail.com ) Academic editor: Peter Mikulíček
© 2021 Rasoul Karamiani, Nasrullah Rastegar-Pouyani, Eskandar Rastegar-Pouyani.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Karamiani R, Rastegar-Pouyani N, Rastegar-Pouyani E (2021) Phylogenetic relationships amongst the snake-eyed lizards of the genus Ablepharus Fitzinger, 1823 (Sauria, Scincidae) in the Iranian Plateau based on mtDNA sequences. Herpetozoa 34: 183-194. https://doi.org/10.3897/herpetozoa.34.e66338
|
We recovered molecular phylogenetic relationships amongst species of the genus Ablepharus in Iran and Iraq. Partial sequences of three mitochondrial genes (cytochrome C oxidase subunit I – COI, 12S rRNA and 16S rRNA) were analysed. In addition, phylogenetic relationships and taxonomic evaluation of Ablepharus species in Cyprus, India, Greece, Turkey and Syria were performed using partial sequences of the 16S rRNA gene. Phylogenetic trees and estimated genetic distances showed that the Ablepharus populations of Iran and Iraq clustered into three distinct clades. One is found in northwest Iran (A. bivittatus in Ardabil, East and West Azerbaijan and Hamedan Provinces). The second clade, formed by A. chernovi, is found only in Uromia. The third and most heterogeneous clade is divided into two subclades, the first includes two lineages of Ablepharus in Khorasan Razavi and Semnan Provinces (A. pannonicus) and in eastern and south-eastern Iran (A. grayanus); the second subclade is distributed in the eastern part of Iraq and west and south-western Iran (Ablepharus sp.). Our analyses indicated that splitting of A. chernovi within the genus occurred in the early Miocene [about 22.5 million years ago (Mya)]. Ablepharus bivittatus diverged 15.2 Mya, in the middle Miocene. Ablepharus pannonicus diverged in the late Miocene (8.4 Mya) and A. grayanus separated in the late Miocene (6.7 Mya). The lineages of eastern Iraq and south-western Iran (Ablepharus sp.) diverged also in the late Miocene (7.0 Mya).
Ablepharus, COI, mitochondrial sequences, 12S rRNA, 16S rRNA, systematics
The family Scincidae encompasses more than 25% of all living genera and species of lizards (
The genus Ablepharus Fitzinger, 1823 contains ten valid species: A. bivittatus (Ménétries, 1832), A. budaki Göçmen, Kumlutaş & Tosunoǧlu, 1996, A. chernovi Darevsky, 1953, A. darvazi Jeremčenko & Panfilov, 1990, A. deserti Strauch, 1868, A. grayanus (Stoliczka, 1872), A. kitaibelii Bibron & Bory, 1833, A. lindbergi Wettstein, 1960, A. pannonicus (Fitzinger, 1824) and A. rueppellii (Gray, 1839) which are distributed in southern Europe (the whole Balkan Peninsula and islands of the Aegean Sea), Turkey, Syria to Egypt, Azerbaijan, Armenia, Caucasus, Tajikistan, Kazakhstan, Kyrgyzstan, Uzbekistan, Turkmenistan, Afghanistan, Iran, Iraq, United Arab Emirates, Pakistan and NW India (
Ablepharus bivittatus, A. chernovi, A. grayanus and A. pannonicus occur in Iran – our study area (
The two-streaked snake-eyed skink, A. bivittatus was first described as Scincus bivittatus from Perimbal, Talysch Mountains and Azerbaijan. Ablepharus bivittatus is distributed in eastern Turkey, northern Iran, Armenia and Azerbaijan (
Chernov’s snake-eyed skink, A. chernovi, was regarded as a subspecies of Ablepharus kitaibelii from vicinity of the settlement Tkhit, Ashtarak Region, in the middle current of the River Razdan, Armenia.
The minor snake-eyed skink, A. grayanus was first described as Blepharosteres grayanus from Waggur District, northeast Kutch, India. Later, it was treated as a subspecies of A. pannonicus (
The Asian Snake-eyed Skink, A. pannonicus, is distributed in a vast area from west to south in the Zagros, central Iranian Plateau and Kopet-Dagh ranges (
In this study, we evaluate the phylogenetic relationships amongst species, based on sequences of three mitochondrial genes: COI, 12S rRNA and 16S rRNA. In addition, divergence times within the genus Ablepharus are estimated and a hypothesis of the historical biogeography on the Iranian Plateau is presented.
The tissue samples of Ablepharus specimens were collected from various populations throughout the Iranian Plateau from April to October 2010 and 2019 (about 150 days in total). Moreover, we used voucher specimens in the Zoological Museum of Tehran University (
The tissues and DNA samples were deposited in the Department of Biology, Hakim Sabzevari University, Sabzevar, Iran. In total, 53 samples were used for this study, including 51 ingroup and two outgroup samples (see Suppl. material
Map of Iran and Iraq showing the sampling localities of Ablepharus bivittatus (squares), A. chernovi (diamond), A. grayanus (circles), Ablepharus sp. (black triangles) and A. pannonicus (white triangles) used in this study. Numbers correspond to specimens listed in Suppl. material
Three mitochondrial genes were selected for molecular phylogenetic analysis: 1) a partial sequence (631 bp) of the protein-encoding COI gene, 2) a partial sequence (360 bp) of the non-coding 12S rRNA and 3) a partial sequence (532 bp) of the non-coding 16S rRNA. The genes were amplified by the polymerase chain reaction (PCR) procedure using primers presented in Table
| Gene | Primer | Orientation | Primer sequence (5’→3’) | Reference(s) |
|---|---|---|---|---|
| 12S rRNA | L12S | F | AAACTGGGATTAGATACCCCACTAT |
|
| H12S | R | GAGGGTGACGGGCGGTGTGT |
|
|
| 16S rRNA | L16S | F | CGCCTGTTTATCAAAAACAT |
|
| H16S | R | CCGGTCTGAACTCAGATCACG |
|
|
| COI | LCOI | F | TNTTMTCAACNAACCACAAAGA |
|
| HCOI | R | GGTCAACAAATCATAAAGATATTGG |
|
|
| H7086 | R | CCTGAGAATARKGGGAATCAGTG |
|
PCR programme used in this study: Primers L12S and H12S (360 bp from the 12S rRNA region), L16S and H16S (532 bp from the 16S rRNA), LCOI and HCOI (631 bp from the COI) and semi-nested (SE) for primers LCOI and H7086 (1111 bp from the COI) of the mtDNA.
| PCR Step | Temperature (12S rRNA; 16S rRNA; COI; SE) [°C] | Duration (12S rRNA; 16S rRNA; COI, SE) [s] |
|---|---|---|
| Denature template | 94 / 94 / 94 / 94 | 30 / 40 / 40 / 40 |
| Anneal primers | 48 / 48 / 49 / 51 | 45 / 40 / 40 / 40 |
| Extension | 72 / 72 / 72 / 72 | 60 / 80 / 90 / 90 |
Alignment of the individual and concatenated COI, 12S rRNA and 16S rRNA sequences was performed with Clustal W (
Pairwise divergence amongst clades derived from the 12S rRNA mitochondrial gene; p-distances (bold) above and K2P below diagonal. Note that the outgroup taxa are Plestiodon elegans and Ophiomorus persicus.
| Clades | 1 | 2 | 3 | 4 | 5 | 6 |
|---|---|---|---|---|---|---|
| 1. Clade A, A. bivittatus | 0.098 | 0.118 | 0.129 | 0.126 | 0.169 | |
| 2. Clade B, A. chernovi | 0.107 | 0.106 | 0.141 | 0.126 | 0.170 | |
| 3. Subclade C1a, A. pannonicus | 0.131 | 0.116 | 0.094 | 0.070 | 0.166 | |
| 4. Subclade C2: Ablepharus sp. | 0.144 | 0.159 | 0.102 | 0.087 | 0.162 | |
| 5. Subclade C1b, A. grayanus complex | 0.141 | 0.139 | 0.075 | 0.094 | 0.156 | |
| 6. Outgroup | 0.195 | 0.197 | 0.190 | 0.184 | 0.177 |
We applied jModelTest 2.1.1 (
Maximum Likelihood (ML) phylogenetic tree was recovered by raxmlGUI 2.0 (
Pairwise divergence amongst clades derived from the 16S rRNA mitochondrial gene; p-distances (bold) above and K2P below diagonal. Note that the outgroup taxa are Plestiodon elegans and Ophiomorus persicus.
| Clades | 1 | 2 | 3 | 4 | 5 | 6 |
|---|---|---|---|---|---|---|
| 1. Clade A, A. bivittatus | 0.073 | 0.055 | 0.056 | 0.061 | 0.141 | |
| 2. Clade B, A. chernovi | 0.077 | 0.092 | 0.082 | 0.093 | 0.152 | |
| 3. Subclade C1a, A. pannonicus | 0.057 | 0.098 | 0.059 | 0.046 | 0.158 | |
| 4. Subclade C2: Ablepharus sp. | 0.059 | 0.087 | 0.062 | 0.060 | 0.157 | |
| 5. Subclade C1b, A. grayanus complex | 0.064 | 0.100 | 0.047 | 0.063 | 0.155 | |
| 6. Outgroup | 0.159 | 0.172 | 0.181 | 0.180 | 0.176 |
Pairwise divergence amongst clades derived from the COI mitochondrial gene; p-distances (bold) above and K2P below diagonal. Note that the outgroup taxa are Plestiodon elegans and Ophiomorus persicus.
| Clades | 1 | 2 | 3 | 4 | 5 | 6 |
|---|---|---|---|---|---|---|
| 1. Clade A, A. bivittatus | 0.227 | 0.224 | 0.21 | 0.246 | 0.208 | |
| 2. Clade B, A. chernovi | 0.232 | 0.166 | 0.169 | 0.197 | 0.183 | |
| 3. Subclade C1a, A. pannonicus | 0.233 | 0.249 | 0.159 | 0.214 | 0.184 | |
| 4. Subclade C2: Ablepharus sp. | 0.217 | 0.256 | 0.185 | 0.197 | 0.197 | |
| 5. Subclade C1b, A. grayanus complex | 0.216 | 0.231 | 0.196 | 0.193 | 0.197 | |
| 6. Outgroup | 0.246 | 0.300 | 0.250 | 0.270 | 0.276 |
BEAST 1.8 (
Of the 360 bp examined for 12S rRNA gene, 67 (18.6%) were variable and 25 (6.9%) were parsimony informative. From the 532 bp of 16S rRNA, 67 (12.5%) were variable and 43 (8.1%) were parsimony informative, of 631 bp of COI 217 (34.4%) were variable and 59 (9.4%) were parsimony informative. In total 1,523 nucleotides were unambiguously aligned in a combined dataset, including 416 (28.3%) variable and 147 (9.6%) parsimony informative sites. The nucleotide frequencies in the combined dataset are as follows: A = 30%, C = 28%, G = 17% and T = 25%. P-distances and corrected genetic distances (K2P;
Pairwise divergence amongst clades derived from the concatenated COI, 12S rRNA and 16S rRNA mitochondrial genes; p-distances (bold) above and K2P below diagonal. Note that the outgroup taxa are Plestiodon elegans and Ophiomorus persicus.
| Clades | 1 | 2 | 3 | 4 | 5 | 6 |
|---|---|---|---|---|---|---|
| 1. Clade A, A. bivittatus | 0.141 | 0.142 | 0.137 | 0.136 | 0.181 | |
| 2. Clade B, A. chernovi | 0.158 | 0.154 | 0.153 | 0.160 | 0.204 | |
| 3. Subclade C1a, A. pannonicus | 0.160 | 0.175 | 0.123 | 0.108 | 0.186 | |
| 4. Subclade C2: Ablepharus sp. | 0.154 | 0.174 | 0.136 | 0.120 | 0.194 | |
| 5. Subclade C1b, A. grayanus complex | 0.153 | 0.182 | 0.118 | 0.133 | 0.189 | |
| 6. Outgroup | 0.210 | 0.240 | 0.217 | 0.228 | 0.220 |
Cladogram of the strict-consensus tree obtained from Bayesian analysis using Plestiodon elegans and Ophiomorus persicus as outgroups. Based on the combined dataset of 1,523 bp of COI, 12S rRNA and 16S rRNA mtDNA genes. Ablepharus bivittatus (Clade 1); A. chernovi (Clade 2); A. pannonicus includes populations from Khorasan Razavi and Semnan Provinces (subclade C1a), A. grayanus complex includes populations from east and south-eastern Iran (subclade C1b) and Ablepharus sp. is contributed in eastern parts of Iraq and the west and southwest of Iran (subclade C2). Numbers next to the nodes are posterior probabilities followed by Maximum Likelihood (ML) bootstrap support values. Significant values are usually those over 90% for BI and over 70% for ML.
Of 536 bp examined for 16S rRNA gene, 143 (26.7%) were variable and 63 (11.8%) parsimony informative. The estimated nucleotide frequencies were: A = 33%, C = 23%, G = 20% and T = 24%. P-distances and K2P distances for the comparison amongst clades are listed in Table
Comparative pairwise divergence amongst all clades in Iran, Iraq, Cyprus, India, Greece, Turkey and Syria derived from the 16S rRNA mitochondrial gene; p-distances (bold) above and K2P below diagonal.
| Clades | Clade_1 | Clade_2 | Clade_3 | Clade_4 | Clade_5 | Clade_6 | Clade_7 | Clade_8 | Clade_9 |
|---|---|---|---|---|---|---|---|---|---|
| Clade_1 | 0.079 | 0.075 | 0.065 | 0.076 | 0.163 | 0.068 | 0.072 | 0.066 | |
| Clade_2 | 0.084 | 0.111 | 0.082 | 0.108 | 0.155 | 0.086 | 0.052 | 0.074 | |
| Clade_3 | 0.079 | 0.120 | 0.068 | 0.058 | 0.188 | 0.104 | 0.107 | 0.110 | |
| Clade_4 | 0.068 | 0.087 | 0.071 | 0.060 | 0.183 | 0.095 | 0.085 | 0.097 | |
| Clade_5 | 0.081 | 0.117 | 0.061 | 0.063 | 0.186 | 0.103 | 0.106 | 0.156 | |
| Clade_6 | 0.186 | 0.175 | 0.219 | 0.213 | 0.218 | 0.159 | 0.175 | 0.156 | |
| Clade_7 | 0.072 | 0.091 | 0.113 | 0.103 | 0.112 | 0.180 | 0.064 | 0.055 | |
| Clade_8 | 0.075 | 0.054 | 0.116 | 0.091 | 0.115 | 0.201 | 0.068 | 0.063 | |
| Clade_9 | 0.069 | 0.078 | 0.119 | 0.105 | 0.119 | 0.176 | 0.058 | 0.067 |
Consensus tree of the Bayesian analysis based on data set of 536 bp of 16S rRNA mtDNA genes. Ablepharus bivittatus (Clade A); A. chernovi (Clade B); A. pannonicus includes populations from Khorasan Razavi and Semnan Provinces (subclade C1a), A. grayanus complex includes populations from east, south-eastern Iran and Indian (A.gra_CES09_858) (subclade C1b), Ablepharus sp. is distributed in eastern parts of Iraq, west and southwest of Iran and (subclade C2), A. kitaibelii Greece; (Clade D), A. budaki Cyprus and Syria (Clade E) and A. kitaibelii Greece and Turkey (Clade F). Numbers next to the nodes are posterior probabilities over 90%.
Estimated divergence times (Fig.
The results of this study show a well-resolved molecular phylogeny and identify species, based on sequence divergence of the genus Ablepharus in Iran and Iraq and their relationship with species existing in Cyprus, India, Greece, Turkey and Syria. Different lineages within the genus Ablepharus have diverged in the early Miocene and have undergone different evolutionary histories. The phylogenetic analyses (ML and BI) reveal at least five lineages of Ablepharus within Iran and Iraq with high bootstrap values and posterior probabilities.
A molecular phylogenetic study confirmed A. chernovi to represent a genetically-distinct species (
Our results showed that, amongst the Iranian Plateau taxa, clade B lies within the populations of south-eastern Europe, Greece, Turkey, Cyprus and Syria and is a sister taxon to A. chernovi from Turkey. This clade divided from A. kitaibelii about 13 Mya. Most likely, A. chernovi reached Iran following its dispersal through the Zagros Mountain belt in south-eastern Turkey and it seems that Uromia Lake was a barrier against its dispersal. Perhaps in higher regions, such as Khoi and Chaldoran, it could not expand because its favourable niches in the area are occupied by A. bivittatus (probably having similar ecological niches). Around the middle Miocene period (about 15 Mya), much of the Tethys Sea in Iran retreated (
The authors thank Prof. Steven C. Anderson (University of the Pacific, Stockton, California, USA) and Prof. Theodore J. Papenfuss (University of California, USA) for their kind help to improve the English of our manuscript. We thank Prof. Alireza Sari and Hassan Salehi from Zoological Museum, University of Tehran, for the loan of some specimens of Ablepharus. We thank Seyyed Saeed Hosseinian Yousefkhani for his help in molecular laboratory and photo of C1a (Fig.
Table S1
Data type: table
Explanation note: Specimens used in this study (the square indicated CO1, 12S and 16S rRNA mitochondrial sequence genes; the circle revealed 16S rRNA gene). Star indicate numbers correspond to specimens listed in Figure