The Malayan Banded Wolf Snake Lycodon subcinctus Boie, 1827 once included three subspecies, namely L. s. subcinctus Boie, 1827, L. s. sealei Leviton, 1955, and L. s. maculatus (Cope, 1985). Thereafter, L. s. sealei has been elevated to species level, and the taxonomic status of L. s. maculatus has not been resolved. We sequenced the mitochondrial cytochrome b (cytb) gene fragments of eight specimens of L. s. maculatus from China, including three from the adjacent areas of its type locality. Combining the sequences obtained from GenBank, we reconstructed a molecular phylogeny and reevaluated the taxonomic status of L. s. maculatus. Phylogenetic analysis revealed three highly divergent lineages within L. subcinctus sensu lato which correspond to L. subcinctus sensu stricto, L. sealei, and L. s. maculatus, respectively. Coupled with morphological comparison, we elevate L. s. maculatus to full species and redescribe it based on the type and freshly collected material.

cytochrome b, morphology, phylogeny, subspecies, systematics, Wolf Snake

Lycodon subcinctus Boie, 1827, a species originally described from Java, was subsequently considered to be widespread, ranging from almost the entire Southeast Asia to southern China and the Nicobar Islands of India (Boulenger 1893; Pope 1935; Smith 1943; Taylor 1965; Zhao 2006; Nguyen et al. 2009; Harikrishnan et al. 2010; Siler et al. 2013; Geissler et al. 2019; Reilly et al. 2019). Cope (1895) once dissected a snake specimen (Cat. No. 7339, U.S.N.M.) from Hong Kong, China, and gave it the name Anoplophallus maculatus Cope, 1895. Stejneger (1926) considered the specimen dissected by Cope (1895) to belong to L. subcinctus, and therefore, the name A. maculatus was taken as a junior synonym of L. subcinctus. Leviton (1955) described a subspecies of L. subcinctus from the Philippines, namely L. s. sealei Leviton, 1955. Afterwards, Lanza (1999) recognized three subspecies within L. subcinctus: L. s. subcinctus Boie, 1827, mainly distributed in West Malaysia, Indonesia (Java, Sumatra), Singapore, Vietnam, Laos, Cambodia, and Thailand; L. s. sealei, mainly distributed in the Philippines, Brunei, and Borneo; and L. s. maculatus (Cope, 1895), mainly distributed in southern China. Currently, L. s. sealei has been elevated to full species (Leviton et al. 2018; Weinell et al. 2019) whereas A. maculatus is still treated as a junior synonym of L. subcinctus (e.g., Uetz et al. 2023) or by some authors, with a subspecific rank of L. subcinctus (e.g., Poyarkov et al. 2023).

In China, Lycodon subcinctus was recorded from Fujian, Guangdong, Hainan, Hunan, Sichuan, and Yunnan provinces, Guangxi Autonomous Region, and Hong Kong and Macao special administrative regions, and no subspecies has been recognized (Pope 1935; Zhao et al. 1998; Zhao 2006; Li et al. 2011; Francis 2021; Huang 2021; Wang 2021; Guo et al. 2022).

When studying Lycodon species in China, we found that there are some morphological differences between the snakes identified as L. subcinctus from China and L. subcinctus from the type locality in Java and the adjacent areas. In addition, molecular result revealed three strongly supported, highly divergent clades within L. subcinctus sensu lato, corresponding to the three subspecies previously considered, namely L. s. subcinctus, L. s. sealei, and L. s. maculatus. Since L. sealei has been treated as a separate species, Anoplophallus maculatus should also be regarded as a valid species, which we presently refer to as Lycodon maculatus comb. nov. (Cope, 1985).

Total genomic DNA was extracted from liver tissue samples. A fragment of mitochondrial cytochrome b (cytb) gene was amplified using newly designed primer pairs SubF1: 5’–GCCAATATTGACTTAGCCTT–3’ and SubR1: 5’–ATTGAAAATGTTTGGGGTGA–3’. Polymerase Chain Reaction (PCR) amplification and sequencing were completed by Tsingke Biotechnology Co., Ltd. Sequences were edited and manually managed using SeqMan in Lasergene 7.1 (DNASTAR Inc., Madison, WI, USA). The new sequences have been deposited in GenBank, homologous sequences were downloaded from GenBank (Table 1). Sequences of Boiga cynodon (Boie, 1827) and Dasypeltis atra Sternfeld, 1912 were used as outgroups according to Wang et al. (2021). The technical computation methods for sequence alignment, genetic distance calculation, the best substitution model selection, and Bayesian inference (BI) and maximum likelihood (ML) phylogenetic analyses were the same as those in Liu et al. (2023).

Measurements and scale counts were taken following Nguyen et al. (2022). SVL: snout-vent length, TaL: tail length, HL: head length, HW: head width, HH: head height, ED: eye diameter, SnL: snout length, EN: eye to narial distance, InD: internarial distance, SL: supralabials, IL: infralabials, SL-E: SL contacting the eye, LoR: loreals, LoR-E: LoR contacting the eye, PrO: preoculars, PtO: postoculars, aTMP: anterior temporals, pTMP: posterior temporals, DSR: dorsal scale rows at one head length posterior to the head, midbody, and one head length anterior to the vent, Ven: ventral scales, SC: subcaudals, Prec: cloacal plate, BB: light-colored body bands, TB: light-colored tail bands.

The resulting topologies from BI and ML analyses are consistent (Fig. 1). All sequences of Lycodon subcinctus sensu lato formed a monophyletic lineage comprising three clades. Clade A included the sequence from the type locality of L. subcinctus, Java, and the sequences from Sumatra, Bengkulu, and the Lesser Sundas (Indonesia), and Pahang (West Malaysia); clade B included the sequences from the type locality of L. sealei, namely Palawan Island, the Philippines; and clade C included the sequences from the adjacent areas of the type locality of Anoplophallus maculatus in Guangdong, and the sequences from Guangxi, Fujian, Sichuan, Hainan, and Yunnan, China, and Nakhon Ratchasima, Thailand. The average genetic distance (uncorrected p-distance) between clades A and B was 6.6%, the average genetic distance (uncorrected p-distance) between clades A and C was 8.8%, and the average genetic distance (uncorrected p-distance) between clades B and C was 8.9%. Therefore, we consider clade C, namely A. maculatus, to be a valid species instead of a strict synonym or a subspecies of L. subcinctus.

Figure 1. 

Bayesian phylogenetic tree of Lycodon inferred from the mitochondrial cytb sequences. Numbers before slashes indicate Bayesian posterior probabilities (>0.90) and numbers after slashes indicate ML bootstrap supports (>90).

 Lycodon maculatus comb. nov. (Cope, 1985)

Figs 2, 3

Type material

Holotype . USNM 7339, adult male.

Type locality

Hong Kong Special Administrative Region, China.

Diagnosis

Body size relatively small, slender; 17-17-15 dorsal scale rows; eight supralabials, 3^rd–5^th or 3^rd–6^th contacting eye; 8–9 infralabials; no preocular; prefrontal contacting eye; two postoculars; one loreal contacting eye; one anterior temporal and two posterior temporals in most individuals; ventral scales less than 205; subcaudal scales more than 70, paired; cloacal plate divided; dorsal scale feebly keeled; anterior part of head dark grey or black; posterior lateral parts of head white in juveniles and dark gray or grayish black in adults; 20–27 distinct white bands on dorsal body and tail in juveniles; 5–8 grayish white bands gradually blur backward on anterior part of body in adults; no bands on posterior part of body and tail in adults.

Figure 2. 

The holotype (USNM 7339) of Lycodon maculatus comb. nov. in preservative. A. Dorsal view; B. Ventral view. Photos are obtained from the website of National Museum of Natural History. Photographer: Teresa Hsu from Division of Amphibians & Reptiles, National Museum of Natural History, Smithsonian Institution.

Redescription of the holotype

Head flattened, somewhat elongate, HL 17.1 mm, HW 9.3 mm, HH 6.7 mm, HL/HW 1.84, HW/HH 1.39, distinct from the neck; snout relatively elongate, SnL 5.4 mm, SnL/HL 0.32, nostril closer to snout than to eye, internarial distance large, InD 4.2 mm, InD/HW 0.45; eye moderately sized, ED 2.0 mm, ED/HL 0.12, with a nearly rounded pupil; rostral approximately triangular, visible from above; two nearly triangular internasals; two large parallelogram-like prefrontals; single shield-shaped frontal; two large, elongate parietals; 1\1 nearly trapezoidal supraocular; no preocular; 2\2 small postoculars, upper one slightly larger than lower one; 1\1 narrow, elongate loreal entering orbit, in contact with nasal anteriorly, prefrontal dorsally, second and third supralabials ventrally; 8\8 supralabials; first and second supralabials in contact with nasal; third, fourth, and fifth supralabials in contact with eye; 1\1 anterior temporal; 2\2 posterior temporals; 8\8 infralabials; first pair infralabials contact medially forming a deep, medial groove; first three infralabials in contact with first pair of chinshields; first pair of chinshields elongate, bearing a deep, medial grooves contiguous with groove separating first pair of infralabials.

Figure 3. 

Lycodon maculatus comb. nov. from China in life. A. The adult female (KIZ20190902) from Hechi City, Guangxi Autonomous Region; B. The adult female (KIZ2023029) from Guangzhou City, Guangdong Province; C. The adult female (KIZ2023030) from Putian City, Fujian Province; D. The adult male (KIZ2023031) from Xishuangbanna Prefecture, Yunnan Province; E. The adult male (KIZ2023032) from Shenzhen City, Guangdong Province; F. An uncollected juvenile from Qingyua City, Guangdong Province.

Body slender; SVL 428 mm; tail incomplete; 191 ventrals; cloacal plate divided; dorsal scales in 17-17-15 rows; vertebral row not enlarged; no apical pits.

After long-term immersion in preservative, head almost entirely white with a little light reddish brown on top; dorsal surface of anterior body reddish brown with seven white bands, first six distinct and last one indistinct; dorsal surface of posterior body and tail pale brown with no bands; ventral surface of head, body, and tail white.

Other specimens examined

We examined eight specimens in Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ) and two specimens in Museum of Herpetology, Chengdu Institute of Biology, Chinese Academy of Sciences (KIZCIB). KIZ2009061301, adult male, from Tian’e County, Hechi City, Guangxi Autonomous Region, China (Exact locality unknown); KIZ20190902, adult female, from Leyi Village, Chuanshan Town, Huanjiang County, Hechi City, Guangxi Autonomous Region, China (25°5'56"N, 108°0'9"E, at an elevation of 570 m); KIZ2023029, adult female, from Huangpu District, Guangzhou City, Guangdong Province, China (23°5'45"N, 113°16'52"E, at an elevation of 200 m); KIZ2023030, adult female, from Hanjiang District, Putian City, Fujian Province, China (Exact locality unknown); KIZ2023031, adult male, from Menglun Town, Mengla County, Xishuangbanna Prefecture, Yunnan Province, China (21°56'9"N, 101°15'10"E, at an elevation of 550 m); KIZ2023032, adult male, from Luohu District, Shenzhen City, Guangdong Province, China (22°34'7"N, 114°14'9"E, at an elevation of 240 m); KIZ2023034, adult male, from Jinghong City, Xishuangbanna Prefecture, Yunnan Province, China (Exact locality unknown); KIZ2023044, juvenile, from Xiegang Town, Dongguan City, Guangdong Province, China (22°54'20"N, 114°14'19"E, at an elevation of 260 m); and KIZCIB 78124 and KIZCIB 9820, two adult females, both from Sanya City, Hainan Province, China (Exact locality unknown) (Fig. 4).

Figure 4. 

Map showing the type locality of Lycodon maculatus comb. nov. in Hong Kong Special Administrative Region, China (1) and the localities of the specimens examined in this study (2–8).

Variation

The morphological data of other specimens are presented in Table 2. All specimens resemble the holotype except that third, fourth, fifth, and sixth supralabials contact eye in some individuals, anterior and posterior temporals vary from one to two, nine infralabials in some individuals, first four infralabials in contact with first pair of chinshields, ventrals vary from 189 to 203, subcaudals vary from 71 to 84, and the bands on dorsal body vary from five to eight in adults and 14 bands on dorsal body and 12 bands on dorsal tail in the juvenile.

Table 2.

Download as

CSV

XLSX

Measurements (in mm) and scalation data of the examined specimens. For abbreviations see Materials and methods. “/” represents injured and incomplete.

	KIZ2009061301	KIZ20190902	KIZ2023029	KIZ2023030	KIZ2023031	KIZ2023032	KIZ2023034	KIZ2023044	KIZCIB 78124	KIZCIB 9820
Sex	Male	Female	Female	Female	Male	Male	Male	Juvenile	Female	Female
SVL	526	464	432	635	425	456	414	237	578	562
TaL	/	108	112	143	114	/	109	56	156	151
HL	18.4	16.6	16.0	20.9	15.9	16.1	15.5	11.5	20.4	17.2
HW	10.3	10.3	9.9	12.1	9.2	9.1	7.4	/	11.7	9.8
HH	7.5	7.8	6.2	8.7	5.3	6.2	5.6	/	7.1	7.0
ED	2.4	2.1	2.2	2.5	2.5	2.0	2.0	1.6	2.6	2.1
SnL	6.5	5.7	5.5	7.0	5.2	5.5	5.2	3.8	6.8	5.9
EN	3.6	3.1	3.3	4.2	2.9	3.1	2.6	1.8	3.6	3.3
InD	4.8	4.1	4.0	5.1	4.0	4.1	4.2	2.0	5.2	4.0
Sl	8\8	8\8	8\8	8\8	8\8	8\8	8\8	8\8	8\8	8\8
IL	9\9	9\9	9\9	9\9	8\9	9\8	9\8	9\9	8\8	9\8
SL-E	345\345	345\345	3456\3456	3456\3456	345\345	3456\3456	345\345	3456\3456	3456\3456	345\345
LoR	1\1	1\1	1\1	1\1	1\1	1\1	1\1	1\1	1\1	1\1
LoR-E	Y	Y	Y	Y	Y	Y	Y	Y	Y	Y
PrO	0\0	0\0	0\0	0\0	0\0	0\0	0\0	0\0	0\0	0\0
PtO	2\2	2\2	2\2	2\2	2\2	2\2	2\2	2\2	2\2	2\2
aTMP	1\1	1\1	1\1	1\1	1\1	1\1	2\2	1\1	1\1	1\1
pTMP	2\2	2\1	2\2	2\2	2\2	2\2	2\2	2\2	2\2	2\2
DSR	17-17-15	17-17-15	17-17-15	17-17-15	17-17-15	17-17-15	17-17-15	17-17-15	17-17-15	17-17-15
Ven	199	195	192	199	200	196	202	/	203	189
SC	/	72	76	71	84	/	82	74	74	71
Prec	divided	Divided	divided	divided	divided	divided	divided	divided	divided	divided
BB	8	6	7	5	7	8	7	14	7	7
TB	0	0	0	0	0	0	0	12	0	0

Morphological comparison

Lycodon maculatus comb. nov. differs from L. subcinctus by having fewer ventral scales, namely less than 205 vs. more than 205. Lycodon maculatus comb. nov. differs from L. sealei by subcaudal scales more than 70 vs. less than 70. In addition, the number of bands on dorsal body and tail is significantly different, although the bands become indistinct in adults, they are usually distinct in juveniles. According to the figures in Siler et al. (2013), Leviton et al. (2018), Francis (2021), and Huang (2021), and Fig. 3F and Table 2 in this paper, the total number of bands on dorsal body and tail of juveniles is less than 15 in L. sealei and more than 40 in L. subcinctus, whereas the number is 20–27 in Lycodon maculatus comb. nov.

Distribution

Lycodon maculatus comb. nov. is currently known to be distributed in southern China and Nakhon Ratchasima, Thailand. As Nakhon Ratchasima is located in central southern Thailand and the nearest confirmed distribution site of Lycodon maculatus comb. nov. is in Xishuangbanna, Yunnan, China, it can be assumed that the species is likely to occur in the area between Nakhon Ratchasima and Xishuangbanna, specifically in northern Thailand and central and northern Laos. In addition, it is likely that the population in northern Vietnam, previously considered to be L. subcinctus, also belongs to Lycodon maculatus comb. nov.

The name Anoplophallus maculatus was synonymized with the name Lycodon subcinctus shortly after its proposal (Stejneger 1926) and later this taxon was considered one of the subspecies of L. subcinctus (Lanza 1999). At present, “The Reptile Database” (Uetz et al. 2023) regarded this taxon as a synonym of L. subcinctus, and Poyarkov et al. (2023) recognized it as a subspecies of L. subcinctus. All literature sources on the snakes of China (e.g., Zhao et al. 1998; Zhao 2006; Zhang 2009; Li et al. 2011; Shi et al. 2011; Wang et al. 2020, 2021; Zhu and Rao 2020; Francis 2021; Huang 2021; Wang 2021) report that L. subcinctus occurs in China, but do not specify any subspecies. Our phylogenetic analysis revealed three lineages within L. subcinctus sensu lato. The first lineage includes sequences from Indonesia (including the Lesser Sundas) and Malaysia and refers to L. subcinctus sensu stricto. The second lineage includes sequences from the Philippines that are related to L. sealei. The last lineage contains sequences of specimens originating from China and Thailand and refers to Lycodon maculatus comb. nov. Currently, L. subcinctus sensu stricto is known to be distributed in Indonesia and Malaysia and their adjacent areas, while L. sealei is known only in the Philippines, and all populations previously considered being L. subcinctus from China belong to Lycodon maculatus comb. nov. Therefore, we remove L. subcinctus from the herpetofauna of China. Since we have not obtained samples from Laos, Vietnam, Cambodia, region of Thailand except Nakhon Ratchasima, and the Nicobar Islands, we are currently unable to determine the taxonomic status of the populations identified as L. subcinctus in these areas. Further studies are needed to clarify what species they belong to.

Many records of Lycodon subcinctus (now Lycodon maculatus comb. nov.) in China are known from the literature. Pope (1935) described three specimens of this species, two from Hainan and one from Fujian, China. He recorded the ventral scales as 197 and 199 in the Hainan specimens and 221 in the Fujian specimen, and the subcaudal scales as 77 and 78 in the Hainan specimens and 77 in the Fujian specimen, respectively. It is worth noting that two of the three specimens described by Pope (1935) are juveniles, one from Hainan and the other from Fujian. He described the juvenile from Hainan as having 13 light cross-bands on the body, but did not mention any bands on the tail. However, he described the juvenile from Fujian as having 16 distinct light cross-bands throughout. For this species, there are 20–27 light bands throughout in juveniles. Since Pope (1935) only described the bands on the body without mentioning the bands on the tail of the juvenile from Hainan, we cannot know the total number of bands on this specimen. However, the total number of bands on the juvenile from Fujian obviously does not match the characteristics of this species. Therefore, we speculate that the juvenile from Fujian described by Pope (1935) does not belong to this species, and the record of 221 ventral scales is questionable. Zhao et al. (1998) recorded the ventral scales of this species as 193–202 and subcaudal scales as 71–78 based on eight voucher specimens from China. Zhao (2006) recorded the ventral scales of this species as 196–227 and subcaudal scales as 72–105 based on seven specimens from Hainan, China, but did not provide the voucher numbers of the specimens. Li et al. (2011) recorded the ventral scales of this species as 193–202 and subcaudal scales as 71–78, but did not provide voucher specimens details from which this data was derived. Shi et al. (2011) recorded that this species has one preocular and 227 ventral scales, and 105 subcaudal scales based on one specimen from Hainan, China, but also did not provide the voucher number of the specimen. An important diagnosis of Lycodon maculatus comb. nov. is the absence of preocular, so it is obvious that Shi et al. (2011) relied on a misidentified specimen, and thus, the numbers of ventral and subcaudal scales they recorded do not belong to this species. Coincidentally, the maximum numbers of ventral and subcaudal scales recorded by Zhao (2006) are the same as those recorded by Shi et al. (2011), and all specimens of this species in Zhao (2006) and Shi et al. (2011) are from Hainan. Thus, the maximum numbers of ventral and subcaudal scales recorded by Zhao (2006) may come from the same specimen as in Shi et al. (2011), which was misidentified as L. subcinctus at that time. In this way, the records of 227 ventral scales and 105 subcaudal scales are also not credible. Currently, there are no reliable records of the number of ventral scales exceeding 205.

Based on molecular and morphological data, we resurrect and elevate the junior synonym subspecies, Lycodon subcinctus maculatus, as a full, valid species, which we refer to as Lycodon maculatus comb. nov. This species is currently confirmed to be distributed in Hong Kong Special Administrative Region, Guangxi Zhuang Autonomous Region, and Guangdong, Fujian, Hainan, Sichuan, and Yunnan provinces, China, and Nakhon Ratchasima, Thailand, based on molecular data. As for whether the populations in the other parts of Thailand and in Laos, Vietnam, Cambodia, and the Nicobar Islands, that were previously considered L. subcinctus, also belong to Lycodon maculatus comb. nov., further research is needed to verify.

We thank Addison Wynn from Division of Amphibians and Reptiles, National Museum of Natural History, Smithsonian Institution, for providing some morphological data of the type specimen (USNM 7339). We thank our supervisors and colleagues for their support and assistance. We thank Jiabin Li for providing photos and valuable information and Decai Ouyang and Zhongqiang Yang for their assistance in the field. We also thank the editors and reviewers for their comments on the manuscript. This work was supported by Science-Technology Basic Condition Platform from the Ministry of Science and Technology of the People’s Republic of China (grant no. 2005DKA21402), Science & Technology Fundamental Resources Investigation Program (grant no. 2022FY100500), Biological Resources Programme, Chinese Academy of Sciences (grant no. KFJ-BRP-017-66), the project of the second comprehensive scientific investigation of Xishuangbanna National Nature Reserve, and the project of Ministry of Ecology and Environment of China: investigation and assessment of amphibians and reptiles in Jinghong City, Menghai County, and Mengla County.